Transformation method of Crypthecodinium cohnii

A technology for transformation of Crypthecodinium columbineum and Agrobacterium, which is applied in the field of genetic engineering and can solve the problems such as the lack of public documents of Crypthecodinium spp.

Active Publication Date: 2015-01-21
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few public literatures on the molecular biology transformation and research of Cryptidinosa
However, there is no report on the genetic engineering of Cryptidium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transformation method of Crypthecodinium cohnii
  • Transformation method of Crypthecodinium cohnii
  • Transformation method of Crypthecodinium cohnii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The desired recombinant Agrobacterium was constructed from the starting Agrobacterium strain, namely Agrobacterium tumefaciens EHA105 (the strain was purchased from Protin Biotechnology (Beijing) Co., Ltd.). The EHA105 strain is a common tool strain well known to researchers in the field. In this experiment, in order to identify whether the transformation was successful or not, a drug resistance gene was introduced to facilitate detection.

[0049] The specific steps are as follows: ① both ends of the hygromycin resistance gene in the pCAMBIA1301 vector have XhoI restriction endonuclease recognition sites, so pCAMBIA1301 (purchased from Cambia Company) was digested with XhoI endonuclease (purchased from Bao Biological Company) to make The hygromycin resistance gene in the vector was completely excised; ② Using the pGAPZαA vector (purchased from Protin Biotechnology (Beijing) Co., Ltd.) as a template, the primers ZEOU (AAAACTCGAGATGGCCAAGTTGACCAGTGC) and ZEOD (AAAACTCGAG...

Embodiment 2

[0065] The resistant colony obtained from the screening plate needs to be verified, and the present invention uses the colony PCR method to test the recombined colony.

[0066]The target gene of the colony PCR test should be any part in the middle of the two T-DNA regions on the pCAMBIA vector, and this part of the nucleic acid will be transferred into the genome of Cryptidium dinoflagellate by Agrobacterium. On the K7 vector used in the present invention, the nucleic acid located between the left border and the right border of the T-DNA repeat mainly includes CaMV35S PolyA, zeocin resistance gene, CaMV35S promoter, multiple cloning site region, CaMV35S promoter, GUS gene and Artificial introns and Nos polyA regions can all be used as targets for PCR testing. The present invention can test the zeocin resistance gene carried by the recombinant Agrobacterium, using primers zeoU: AAAACTCGAGATGGCCAAGTTGACCAGTGC and zeoD: AAAACTCGAGTCAGTCCTGCTCCTCGGCCA. The PCR amplification metho...

Embodiment 3

[0070] Cryptidium and Agrobacterium were cultured according to the steps described in Example 1, and CA-1 was used as a medium for pre-cultivating Cryptidium.

[0071] Taking the ATCC30772 strain as an example, the difference in the effect of Agrobacterium transformation in the growth stage of the bacteria has been analyzed in Example 1. That is, ATCC30772 was cultured to early logarithmic phase and late logarithmic phase, respectively. The result is as follows Figure 5 It was shown that Cryptidinium in the early logarithmic period was more affected by the transformation conditions and could obtain better transformation efficiency.

[0072] Also taking the ATCC30772 strain as an example, the effect of different concentrations of treatment solutions on the transformation efficiency was studied. Generally, researchers often use the induction medium (IM) as a solution for suspending Cryptidinosa, but our experiments again found that under the osmotic pressure conditions, the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a transformation method of Crypthecodinium cohnii. The method includes the following steps: pre-culturing Crypthecodinium cohnii; pre-culturing Agrobacterium; suspending the Crypthecodinium cohnii and Agrobacterium in the presence of an osmotic pressure regulator, and co-culturing complete Crypthecodinium cohnii cells and with Agrobacterium; and acquiring Agrobacterium transformed Crypthecodinium cohnii.

Description

technical field [0001] The invention relates to the field of genetic engineering. Specifically, it relates to a method for transforming Cryptidium koii with Agrobacterium. Background technique [0002] Crypthecodinium cohnii is classified according to the NCBI Taxonomy database and belongs to the genus Crypthecodinium of the Crypthecodiniaceae family of the Eukaryota kingdom Alveolata (vesicles) Dinophyceae (Dinophyta) Gonyaμlacales order. This algae is a relatively primitive eukaryotic organism with discontinuous nuclear membrane, highly condensed chromosomes, and thick cell walls [Liu Xiaoling et al., Extraction of Chromosomes of Cryptodinium koulii and Its Unique Ultrastructure, Journal of Experimental Biology , 2000, 33(2): 189-1]. [0003] Cryptidinium koushii has better synthesis ability of docosahexaenoic acid (DHA). DHA accounts for more than 30% of cell lipids [Wynn et al. Production of single cell oils by dinoflagellates, in Single Cell Oil (ZVi Cohen&Colin Ratl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/79C12R1/89
Inventor戴小军许骏蔡南海姜翠红
OwnerWILMAR SHANGHAI BIOTECH RES & DEV CENT