Preparation method of recombinant antigen for detecting swine fever virus
A technology of swine fever virus and recombinant antigen, which is applied in the field of biotechnology and diagnostic research, can solve the problems of low accuracy and achieve the effects of short production cycle, large expression amount and avoiding missed detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] The synthesis of embodiment 1 classical swine fever virus E2 gene
[0087] Primers were designed as follows:
[0088] CSFV-1u:
[0089] ATGCAGCTAGCCTGCAAGGAAGATTACAGGTACGCAATATCATCAACCAATGAGATA
[0090] CSFV-1d:
[0091] ATTCTTTCCAGGTGGTGGTGAGACCTCCGGCCCCGAGTAGCCCTATCTCATTGGTTGA
[0092] CSFV-2u:
[0093] CCACCTGGAAAGAATACAACCACGATTTGCAACTGAATGACGGGACCGTTAAGGCCATT
[0094] CSFV-2d:
[0095] TGACCACATTAAGTGCTGTGACTTTAAAGGAACCTGCCACGCAAATGGCCTTAACGGT
[0096] CSFV-3u:
[0097] CACTTAATGTGGTCAGTAGGAGGTATTTGGCATCATTGCATAAGGAGGCTTCACTCACT
[0098] CSFV-3d:
[0099] GAGGCTTCACTCACTTCCGTGACATTTGAGCTCCTGTTCGACGGGACCAACCCATCAAC
[0100] CSFV-4u:
[0101] CAAATGGGCACAGCCCGAACCCGAAGTCATCTCCCATTTTCTCAGTTGATGGGTTGGTC
[0102] CSFV-4d:
[0103] CAAGGTTGTGTTGTACTTTTCCCTTGACAACAGGACTCGTATCAAATGGGCACAGCC
[0104] CSFV-5u:
[0105] TACAACACAACCTTGTTGAACGGTAGTGCTTACTATCTTGTCTGTCCAATAGGGTGGAC
[0106] CSFV-5d:
[0107] TTCTCAGAGTTGTTGGGCTCACTGCTGTGCACTCTATAACACCCGTCCACCCTA...
Embodiment 2
[0145] Embodiment 2 constructs the recombinant expression vector,
[0146] After the sequencing proved that the sequence was correct, the PCR product in Example 1 was cut with NdeI and XhoI restriction endonucleases (various molecular biology enzymes used in the present invention were purchased from NEB Company) and then inserted into the The same two enzyme-digested pET30a (Novagen product, Cat. No. 69909-3) vectors.
Embodiment 3
[0147] Embodiment 3 combines the expression of classical swine fever virus E2 recombinant protein
[0148] The recombinant expression plasmid of classical swine fever virus was transformed into Escherichia coli BL21, spread on an LB plate containing 100ug / ml kanamycin sulfate (Shanghai Sangon Bioengineering Service Co., Ltd., article number: KB0286), and cultivated overnight at 37. Pick a single clone colony, culture it with 300ml LB medium containing the same concentration of kanamycin sulfate at 37 degrees until the OD600 reaches about 0.6, and induce the expression with IPTG (Shenggong, product number: IB0168) with a final concentration of 0.1mM. The induction conditions are: 37 degrees, rotation speed 250rpm, 5h. After induction, the culture solution was centrifuged at 5000 rpm at 4 degrees for 20 minutes to collect the bacteria.
[0149] figure 1 It is a schematic diagram of the induced expression of the recombinant plasmid in Escherichia coli in the embodiment of the p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 