Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of recombinant antigen for detecting swine fever virus

A technology of swine fever virus and recombinant antigen, which is applied in the field of biotechnology and diagnostic research, can solve the problems of low accuracy and achieve the effects of short production cycle, large expression amount and avoiding missed detection

Inactive Publication Date: 2015-01-28
HANGZHOU NUOWEI TAIKE BIOTECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, most production raw material companies select some fragments of CSFV E2 or recombine the selected fragments in the diagnostic products of CSFV antibody. The accuracy rate is not high, especially the phenomenon of false negatives.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombinant antigen for detecting swine fever virus
  • Preparation method of recombinant antigen for detecting swine fever virus
  • Preparation method of recombinant antigen for detecting swine fever virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] The synthesis of embodiment 1 classical swine fever virus E2 gene

[0087] Primers were designed as follows:

[0088] CSFV-1u:

[0089] ATGCAGCTAGCCTGCAAGGAAGATTACAGGTACGCAATATCATCAACCAATGAGATA

[0090] CSFV-1d:

[0091] ATTCTTTCCAGGTGGTGGTGAGACCTCCGGCCCCGAGTAGCCCTATCTCATTGGTTGA

[0092] CSFV-2u:

[0093] CCACCTGGAAAGAATACAACCACGATTTGCAACTGAATGACGGGACCGTTAAGGCCATT

[0094] CSFV-2d:

[0095] TGACCACATTAAGTGCTGTGACTTTAAAGGAACCTGCCACGCAAATGGCCTTAACGGT

[0096] CSFV-3u:

[0097] CACTTAATGTGGTCAGTAGGAGGTATTTGGCATCATTGCATAAGGAGGCTTCACTCACT

[0098] CSFV-3d:

[0099] GAGGCTTCACTCACTTCCGTGACATTTGAGCTCCTGTTCGACGGGACCAACCCATCAAC

[0100] CSFV-4u:

[0101] CAAATGGGCACAGCCCGAACCCGAAGTCATCTCCCATTTTCTCAGTTGATGGGTTGGTC

[0102] CSFV-4d:

[0103] CAAGGTTGTGTTGTACTTTTCCCTTGACAACAGGACTCGTATCAAATGGGCACAGCC

[0104] CSFV-5u:

[0105] TACAACACAACCTTGTTGAACGGTAGTGCTTACTATCTTGTCTGTCCAATAGGGTGGAC

[0106] CSFV-5d:

[0107] TTCTCAGAGTTGTTGGGCTCACTGCTGTGCACTCTATAACACCCGTCCACCCTA...

Embodiment 2

[0145] Embodiment 2 constructs the recombinant expression vector,

[0146] After the sequencing proved that the sequence was correct, the PCR product in Example 1 was cut with NdeI and XhoI restriction endonucleases (various molecular biology enzymes used in the present invention were purchased from NEB Company) and then inserted into the The same two enzyme-digested pET30a (Novagen product, Cat. No. 69909-3) vectors.

Embodiment 3

[0147] Embodiment 3 combines the expression of classical swine fever virus E2 recombinant protein

[0148] The recombinant expression plasmid of classical swine fever virus was transformed into Escherichia coli BL21, spread on an LB plate containing 100ug / ml kanamycin sulfate (Shanghai Sangon Bioengineering Service Co., Ltd., article number: KB0286), and cultivated overnight at 37. Pick a single clone colony, culture it with 300ml LB medium containing the same concentration of kanamycin sulfate at 37 degrees until the OD600 reaches about 0.6, and induce the expression with IPTG (Shenggong, product number: IB0168) with a final concentration of 0.1mM. The induction conditions are: 37 degrees, rotation speed 250rpm, 5h. After induction, the culture solution was centrifuged at 5000 rpm at 4 degrees for 20 minutes to collect the bacteria.

[0149] figure 1 It is a schematic diagram of the induced expression of the recombinant plasmid in Escherichia coli in the embodiment of the p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a recombinant antigen for detecting a swine fever virus. The preparation method of the recombinant antigen for detecting the swine fever virus comprises the following steps: synthesizing gene, constructing a recombinant expression vector, expressing an E2 recombinant protein containing the swine fever virus, converting a recombinant expression plasmid to Escherichia coli in order to carry out inducible expression, and collecting thalli after induction; and purifying and renaturating the recombinant protein containing swine fever virus. The E2 full fragment of main antigen epitopes of the swine fever virus is recombined and expressed, so all antigen determinant sites of the E2 are reserved, thereby the false negative phenomenon, that is detection leakage, is effectively avoided; and the preparation method of the recombinant antigen for detecting the swine fever virus has the advantages of short production period, high output and low cost.

Description

technical field [0001] The invention belongs to the field of biotechnology and diagnosis research, in particular to a method for preparing a recombinant antigen used for detecting swine fever virus. Background technique [0002] Classical swine fever virus (CSFV) is a highly contagious and highly fatal febrile infectious disease caused by classical swine fever virus (CSFV). It can cause various clinical manifestations such as febrile systemic sepsis, sow abortion, fetal malformation, etc., thereby bringing serious harm to the pig industry. The World Veterinary Bureau listed it as one of the 16 legal infectious diseases of Class A. Today, swine fever is still the number one infectious disease in my country's pig industry. With the advancement of diagnostic technology and epidemic prevention, the occurrence of swine fever in the world has shown a decreasing trend. The use time and effect of the swine fever vaccine also affect the harm of the swine fever virus. Therefore, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/40C12N15/70C07K14/08G01N33/569
Inventor 吴晓杰
Owner HANGZHOU NUOWEI TAIKE BIOTECH