Method for digitally and quantitatively detecting nucleic acid based on DNA (deoxyribonucleic acid) chip

A DNA chip and quantitative detection technology, which is applied in the field of bioengineering, can solve problems such as difficult to achieve digital accurate detection level, and achieve the effects of saving amplification time, high feasibility, and high specificity of amplification efficiency

Inactive Publication Date: 2015-02-18
XUZHOU MEDICAL COLLEGE
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] With the application of high-volume sequencing technology, the requirements for nucleic acid quantitative analysis are getting higher and higher. At present, these nucleic acid detection technologies are difficult to achieve the level of digital and accurate detection.
If these relatively backward quantitative detection technologies are used to quantitatively analyze the current advanced sequencing data, it will obviously not meet the requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for digitally and quantitatively detecting nucleic acid based on DNA (deoxyribonucleic acid) chip
  • Method for digitally and quantitatively detecting nucleic acid based on DNA (deoxyribonucleic acid) chip
  • Method for digitally and quantitatively detecting nucleic acid based on DNA (deoxyribonucleic acid) chip

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0021] Example 1 Fluorescence probe hybridization method to detect the expression of pain-related gene BDNF in VTA region

[0022] Design the following sequence:

[0023] Bdnf-P: 5'P-GCGTGCAAATTG CCCTATAGTGAGTCGTATTACTATAGTGTCACCGGCAAAGGATCG3';

[0024] Gapdh-P: 5'P GTTATCGTGTAGCCCTATAGTGAGTCGTATTAGTTAGTCACTACTGCACAACTGGTT3';

[0025] IM-primer: 5'amino-TTTTTTTTTTTTTAATACGACTCACTATAGGG3';

[0026] Probe1: 5'cy3-CTATAGTGTCACC3';

[0027] Probe2: 5'cy5-GTTAGTCACTACT3';

[0028] T18: TTTTTTTTTTTTTTTTT.

[0029] The total RNA of mouse VTA region was extracted, and the RNA was converted into cDNA using reverse transcription primer T18 and reverse transcription kit. The reverse transcribed cDNA was added to the ligation reaction system, and Bdnf-P and Gapdh-P were mixed together to carry out the ligation reaction to connect Bdnf-P and Gapdh-P into circular single-stranded DNA (the At the same time, an aldehyde group-modified DNA chip was prepared, and the amino-modified primer...

example 2

[0030] Example 2 Microsequencing was used to detect the expression of pain-related genes BDNF, NNAT and internal reference gene GAPDH in VTA region.

[0031] Design the following sequence:

[0032] Bdnf-P: 5'P-GCGTGCAAATTG CCCTATAGTGAGTCGTATTACTATAGTGTCACCGGCAAAGGATCG3';

[0033] Gapdh-P: 5'PGTTATCGTGTAGCCCTATAGTGAGTCGTATTAGTTAGTCACTACTGCACAACTGGTT3';

[0034] Nnat-P: 5'PGCTGCAGGTGTTCCCTATAGTGAGTCGTATTATTGATCCATGAGACTTCCGCGTGCT3';

[0035] IM-primer: 5'amino-TTTTTTTTTTTTTAATACGACTCACTATAGGG3';

[0036] T18:TTTTTTTTTTTTTTTTTT;

[0037] Seq-primer: CCCTATAGTGAGTCGTATTA.

[0038] According to the method of Example 1, Bdnf-P, Gapdh-P and Nnat-P were ligated into a single-stranded DNA loop. After single-molecule solid-phase amplification, the Seq-primer was hybridized with the amplification template, and then the fluorescently labeled cy3- dCTP, cy5-dGTP, fam-dUTP and the corresponding polymerase system were extended together, and the fluorescence signal was observed under a c...

example 3

[0039]Example 3 Microsequencing was used to detect the expression of pain-related genes BDNF, NNAT and internal reference gene GAPDH in the VTA region of mice with different treatments.

[0040] The reagents and methods are the same as those used in Example 2, except that the prepared immobilized IM-primer divides a DNA chip into different regions by a water-blocking pen or other means, and different regions are used to amplify different treated samples.

[0041] like figure 1 As shown, the nucleic acid molecule e to be detected, in which a is complementary to d, b is the reverse complementary sequence to the primer sequence immobilized on the DNA chip, c is any DNA sequence, which can be probed by fluorescent labeling through the principle of DNA complementary pairing hybridization Needle detection or detection by micro-sequencing methods, such as figure 2 shown, the ligase system and template e, the sequence can be connected into a loop when the ligase system and template ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for digitally and quantitatively detecting nucleic acid based on a DNA (deoxyribonucleic acid) chip. The method comprises the following steps: fixing an amplification primer to the chip; amplifying target nucleic acid through a single nucleic acid molecule template; marking information on a probe and amplified nucleic acid hybridization detection marked gene or reading out molecule information of amplified nucleic acid through a minisequencing process to read out signals of all cloned points, wherein each signal point represents the number of original target DNA molecules; performing statistics on the number of signal points and calculating the number of nucleic acid. A new method is provided for quantitative analysis of nucleic acid molecules, and a quick, accurate and cheap nucleic acid detection technology is built.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for digitally quantitatively detecting nucleic acid based on a DNA chip. Background technique [0002] All life components are inseparable from proteins, and proteins are encoded by nucleic acids, so nucleic acids can be said to be the foundation of life. Nucleic acids (such as DNA) contain the blueprint for all living organisms, and the study of nucleic acid sequences is critical to life sciences. With the development and completion of the Human Genome Project and the genome projects of various model organisms, human beings have entered the post-gene era, which has had a huge impact on contemporary biological research and medical research, and the related disciplines of molecular biology have been rapidly developed develop. In the process of nucleic acid research, in addition to focusing on its sequence, mutation and other qualitative aspects, peopl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6837C12Q1/6874C12Q2565/537C12Q2565/543
Inventor 李燕强韩文灿潘志强夏静许可
Owner XUZHOU MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap