Method for producing hyaluronic acids with different molecular weights through reasonable regulation

A technology of hyaluronic acid and hyaluronic acid synthase, applied in the field of bioengineering, can solve problems such as large differences in molecular weight, and achieve the effect of large application advantages

A technology of hyaluronic acid and hyaluronic acid synthase, applied in the field of bioengineering, can solve problems such as large differences in molecular weight, and achieve the effect of large application advantages

CN104371965AInactive Publication Date: 2015-02-25JIANGNAN UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing hyaluronic acids with different molecular weights through reasonable regulation
  • Method for producing hyaluronic acids with different molecular weights through reasonable regulation
  • Method for producing hyaluronic acids with different molecular weights through reasonable regulation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of integrated recombinant plasmid pAX01-hasA

[0035] The hyaluronic acid synthase hasA gene used in the present invention is derived from Streptococcus zooepidemicus ATCC 35246. The Streptococcus zooepidemicus is inoculated in 5ml M17 liquid medium and cultured at 37° C. and 200 rpm for 16 hours. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus was extracted using a bacterial genome extraction kit.

[0036] According to the published genome information sequence, the primers hasA-F / hasA-R were respectively designed, and the extracted genomic DNA was used as a template to amplify and obtain the hasA gene using a standard PCR amplification system and program.

[0037] Primer sequence information: 5'-3' direction

[0038] hasA-F: CGCGGATCCATGAGAACATTAAAAAACCTCATAAC

[0039] hasA-R: TGCATGCATTTATAATAATTTTTACGTGTTCC

[0040] BamHI and SacII restriction enzyme sites were introduced at both ends of the upstream and downs...

Embodiment 2

[0041] Example 2 Construction of recombinant plasmids pP43NMK / tuaD, pP43NMK / tuaD-gtaB, pP43NMK / tuaD-gtaB-pgcA

[0042] Bacillus subtilis 168 strain was inoculated in 5ml LB medium, cultured at 37°C, 200rpm for 16h. The bacteria were collected, and the genomic DNA of Streptococcus zooepidemicus was extracted using a bacterial genome extraction kit. According to the published genome information sequence of Bacillus subtilis168, primers tuaD-F / tuaD-R, gtaB-F / gtaB-R and pgcA-F / pgcA-R were designed respectively. Introduce KpnI restriction enzyme site and P43 RBS sequence (AAGAGAGGAATGTACAC) at the 5 end of upstream primer tuaD-F, introduce XhoI and SacI restriction enzyme site at the 5 end of downstream primer tuaD-R; The SacI restriction site and P43 RBS sequence were introduced into the 5 end of F, the XhoI and XbaI restriction site were introduced into the 5 end of the downstream primer gtaB-R; the SpeI (XbaI) was introduced into the 5 end of the upstream primer pgcA-F The sam...

Embodiment 3

[0054] Example 3 Construction of recombinant plasmids pP43NMK / glmU, pP43NMK / glmU-glmM, pP43NMK / glmU-glmM-glmS, pP43NMK / glmU-glmM-glmS-pgi

[0055] According to the published genome information sequence of Bacillus subtilis 168, primers glmU-F / glmU-R, glmM-F / glmM-R, glmS-F / glmS-R and pgi-F / pgi-R were designed respectively. A KpnI restriction enzyme site and P43 RBS sequence were introduced at the 5-end of the upstream primer glmU-F, and XhoI and XbaI restriction enzyme sites were introduced at the 5-end of the downstream primer glmU-R. The XbaI homologous enzyme was connected; the SpeI restriction enzyme site and the P43 RBS sequence were introduced at the 5 end of the upstream primer glmM-F, and the XhoI and XbaI restriction enzyme site were introduced at the 5 end of the downstream primer glmM-R; A SpeI restriction site and P43 RBS sequence were introduced into the 5-end of the upstream primer glmS-F, and XhoI and XbaI restriction sites were introduced into the 5-terminus of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing hyaluronic acid with different molecular weights through reasonable regulation, belonging to the technical field of bioengineering. The method comprises the following steps: integrating hyaluronic synthase hasA from streptococcus zooepidemicus on a bacillus subtilis genome; performing modularized assembly and expression analysis on genes of UDP-GlcA and UDP-GlcNAc synthetic routes in bacillus subtilis, and producing hyaluronic acids with different molecular weights from the bacillus subtilis by controlling different UDP-GlcA and UDO-GlcNAc concentrations. The method disclosed by the invention can be used for laying a certain foundation for efficiently preparing the hyaluronic acids within a specified molecular weight range and is suitable for industrial production and application.

Description

technical field [0001] The invention relates to a method for producing hyaluronic acid with different molecular weights through rational control and belongs to the technical field of bioengineering. Background technique [0002] Hyaluronic acid (HA for short), also known as hyaluronic acid, is a highly viscous substance that was first isolated from the vitreous body of the bull’s eye by Meyer and Palmer in 1934. Its unique molecular structure and physical and chemical properties make it With good moisture retention, viscoelasticity, permeability and extensibility, it is the best moisture retention substance found in nature. HA is composed of repeated links of disaccharide units linked by N-acetylglucosamine and D-glucuronic acid by β-(1-3) and β-(1-4) glycosidic bonds. According to different biological functions, HA can be divided into three categories according to molecular weight: macromolecular HA (molecular weight ≥ 1.0×10 6 ); medium molecule HA (<1.0×10 4 ~1.0×10...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
25 Feb 2015
Publication
CN104371965A
IPC
C12N1/21; C12P19/26; C12R1/125
CPC
C12N9/104; C12N9/0006; C12N9/1051; C12N9/1241; C12N9/90; C12N9/92; C12P19/26; C12Y101/9901
Inventors
康振; 陈坚