LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos

A peanut and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of peanut bacterial wilt, threat to peanut yield and quality, negative correlation between resistance and high yield and high quality, and achieve important application value, Effect of Improving Resistance to Bacteria Wilt

Inactive Publication Date: 2015-04-01
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a soil-borne disease, peanut bacterial wilt is very serious, which will cause peanut production reduction or even failure, seriously threatening peanut production and quality
The occurrence of the disease cannot be effectively prevented and controlled through conventional chemical agents and biological control, and the epidemic and spread of the disease cannot be truly and effectively solved through reasonable crop rotation, intercropping and intercropping. The most effective means is to cultivate disease-resistant varieties, but the traditional There is a negative correlation between resistance and high yield and high quality in the disease-resistant varieties bred by cross-breeding methods. The cloning of disease-resistance-related genes and the use of genetic engineering to transform disease-resistance-related genes into peanuts to obtain high-yield, high-quality, high-quality and bacterial wilt-resistant peanut varieties are effective solutions. Effective Ways of Peanut Infected by Bacteria Wilt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos
  • LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos
  • LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] [Example 1] RACE acquisition AhRLK6 Gene 3' Unknown Sequence and 5' Unknown Sequence

[0018]Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_6_F (5'-ACGAGATTCGCTTCATGACGAGCCTC-3') and PRRS_6-R (5'-TCTAAGCATTCCTACCCACCTCCTCTG-3'); then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_6-R primers and RACE-F primers and PRRS_6_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→57°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycles→ (...

Embodiment 2

[0019] [Example 2] AhRLK6 Subcellular localization of gene expression products

[0020] For the subcellular localization vector, amplify from the plasmid with complete reading frame by AhRLK6-SL-F (5'-ATTAGGATCCACCATGAGAACCTCATTGTGTTGTAG-3') and AhRLK6-SL-R (5'-ATTAGGCGCGCCAGAGATTAATTAGGTTATGATGGGT-3') primers get excluding the kill password AhRLK6 Gene cDNA, with BamH1 and Asc1 restriction sites at the 5' end and 3' end respectively, for the pBI-GFP constructed in our laboratory and the amplified AhRLK6 The gene was double digested with BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) at the same time, and p35S was constructed after ligation and transformation:: AhRLK6 ::GFP vector. Agrobacterium GV3101 was transformed by liquid nitrogen freeze-thaw method, and p35S::GFP was used as a control, and Agrobacterium infiltration method was used to transform Nicotiana benthamiana. After culturing at 25°C for 48 hours, the green fluorescence was observed w...

Embodiment 3

[0021] [Example 3] AhRLK6 Analysis of expression patterns after treatment with R. solanacearum resistant and susceptible to R. solanacearum

[0022] In order to analyze the difference in the expression of AhRLK6 gene in bacterial wilt resistant and susceptible peanut varieties inoculated with R. XH) After inoculation of R. solanacearum by leaf cutting method, the expression of the gene was analyzed at different time points. The total RNA of peanut and tobacco leaves was extracted by the CTAB method, and single-stranded cDNA was synthesized by reverse transcription according to the instructions of PrimeScript Reverse Transcriptase reverse transcriptase (purchased from TAKARA Company). The single-stranded cDNA was diluted 10 times, 2 μL was used as a template, and Ahactin, Ntactin As an internal reference gene, Eppendorf Mastercycler ep realplex real-time fluorescent quantitative PCR instrument was used for quantitative PCR reaction. According to the reaction system of TAKARA S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LRR-RLK (leucine-rich repeat receptor-like kinase) gene AhRLK6 associated with bacterial wilt resistance of arachis hypogaea.L and a construction method of an over-expression vector of the gene and in particular relates to an application of the gene AhRLK6 in arachis hypogaea.L to tobacco bacterial wilt resistant gene engineering, belonging to the technical field of plant gene engineering. The gene contains nucleotide sequences shown in SEQ ID No.1. The over-expression vector is constructed to transform Cuibi-1 tobaccos, the transgenic plants are inoculated with ralstonia solanacearum through molecular detection, and over-expression of the over-expression vector in the tobaccos can conduce to obviously improving the resistance of the transgenic tobaccos to bacterial wilt, thereby indicating that AhRLK6 possibly participates in the defence reaction of the plants to ralstonia solanacearum, which lays the foundation for bacterial wilt resistant genetic breeding of the plants and strongly promotes the development and application of the tobacco bacterial wilt resistant gene engineering.

Description

technical field [0001] The invention relates to a peanut bacterial wilt resistance-related LRR receptor protein kinase gene AhRLK6 and the construction of its overexpression vector, more related to the peanut AhRLK6 The application of genes in genetic engineering of resistance to tobacco bacterial wilt belongs to the technical field of plant genetic engineering. Background technique [0002] by Ralstia solanacearum ( Ralstonia solanacearum ) caused by bacterial wilt is one of the most widespread bacterial diseases in the world, which can infect more than 450 species of plants in 54 families. As a soil-borne disease, peanut bacterial wilt is very serious, which can cause peanut production reduction or even failure, and seriously threaten peanut production and quality. The occurrence of the disease cannot be effectively prevented and controlled through conventional chemical agents and biological control, and the epidemic and spread of the disease cannot be truly an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00
Inventor张冲庄伟建陈华邓烨蔡铁城
OwnerFUJIAN AGRI & FORESTRY UNIV