Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Peanut nbs‑lrr gene and its application in tobacco bacterial wilt resistance

A gene and peanut technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems affecting peanut bacterial wilt resistance molecular breeding, etc., and achieve the effect of improving bacterial wilt disease resistance and important application value

Inactive Publication Date: 2017-02-22
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The molecular biological mechanism of peanut bacterial wilt has not been studied, which seriously affects the molecular breeding of peanut bacterial wilt resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peanut nbs‑lrr gene and its application in tobacco bacterial wilt resistance
  • Peanut nbs‑lrr gene and its application in tobacco bacterial wilt resistance
  • Peanut nbs‑lrr gene and its application in tobacco bacterial wilt resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] [Example 1] RACE obtains 3' unknown sequence and 5' unknown sequence of AhRRS5 gene

[0020]Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_5_F (5'- GCTTTGTAGAGGCAAATCAAGGCTG -3') and PRRS_5-R (5'- TGAAGAGAAGGCATCCAATCAGGTAAG -3'); then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_5-R primers and RACE-F primers and PRRS_5_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→57°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycles→ ...

Embodiment 2

[0021] [Example 2] Construction and verification of AhRRS5 overexpression vector

[0022] AhRRS5 including the stop codon was amplified from a plasmid with a complete reading frame by the primers AhRRS5-OE-F (5'- ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-OE-R (5'- ATTTAGGCGCGCCTACACCTTTGAGAGAGTGCTGCGT-3') The cDNA open reading frame of the gene, with BamH1 and Asc1 restriction sites at the 5′ and 3′ ends, was used simultaneously for the pBI121-GUSA driven by the 2×CaMV 35S promoter constructed in our laboratory and the amplified AhRRS5 target fragment BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) were double digested, the target fragment was recovered, ligated with T4 ligase overnight at 16°C, transformed into E. coli DH5α strain, and p35S::AhRRS5-OE overexpression vector was constructed. After PCR verification and enzyme digestion verification, the correctness of the vector construction was confirmed. The vector diagram is as follows: fig...

Embodiment 3

[0023] [Example 3] Subcellular localization of AhRRS5 gene expression product

[0024] For subcellular localization vectors, amplify from a plasmid with complete reading frame by primers AhRRS5-SL-F (5'-ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-SL-R (5'-ATTAGGCGCGCCACACCTTTGAGAGAGTGCTGCGT-3') Obtain the cDNA of the AhRRS5 gene without the stop codon, with BamH1 and Asc1 restriction sites at the 5′ end and the 3′ end, respectively. The pBI-GFP constructed in this laboratory and the amplified AhRRS5 gene were simultaneously digested with BamH1 and Asc1. , construct p35S::AhRRS5::GFP vector after ligation and transformation. The successfully identified recombinant plasmid was bombarded with a gene gun on the onion epidermis, and after being introduced into the onion epidermis, the plate was placed in a tissue culture room and cultured in the dark for 24-36 hours, so that the GFP fusion protein encoded by the plasmid was fully expressed in the onion epidermis. Then the o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene AhRRS5 associated with bacterial wilt resistance of arachis hypogaea.L, a construction method of an over-expression vector of the gene and an application of the gene AhRRS5 or the over-expression vector to tobacco bacterial wilt resistant gene engineering, belonging to the technical field of plant gene engineering. The gene contains nucleotide sequences shown in SEQ ID No.1. The over-expression vector is constructed to transform tobaccos, and over-expression of the over-expression vector in the tobaccos can conduce to obviously improving the resistance of the transgenic tobaccos to bacterial wilt through ralstonia solanacearum inoculation identification and molecular detection of the transgenic plants, thereby indicating that AhRRS5 plays an important regulating role in responses of the plants to ralstonia solanacearum infection, which has important significance in bacterial wilt resistant gene engineering breeding application of the plants and strongly promotes the development and application of the tobacco bacterial wilt resistant gene engineering.

Description

technical field [0001] The invention relates to the construction of a peanut bacterial wilt resistance-related gene AhRRS5 and its overexpression vector and its application in tobacco bacterial wilt resistance genetic engineering, belonging to the technical field of plant genetic engineering. Background technique [0002] Plants will be infested by pathogenic organisms such as bacteria, viruses, fungi, and insects during their growth and development. However, due to the complex and long process of biological evolution, plants have formed a complete set of effective defense against disease infection. mechanism. During the interaction between plants and pathogens, some pathogens are prevented from being killed by the plant's first line of defense, some are suppressed by PTI in the plant's innate immune system, but some pathogens maintain the pathogenic bacteria by secreting virulence factors. Toxicity, these virulence factors inhibit PTI, trigger plant susceptibility, and cau...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00
Inventor 庄伟建张冲陈华邓烨蔡铁城
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com