Peanut nbs‑lrr gene and its application in tobacco bacterial wilt resistance
A gene and peanut technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems affecting peanut bacterial wilt resistance molecular breeding, etc., and achieve the effect of improving bacterial wilt disease resistance and important application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] [Example 1] RACE obtains 3' unknown sequence and 5' unknown sequence of AhRRS5 gene
[0020]Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_5_F (5'- GCTTTGTAGAGGCAAATCAAGGCTG -3') and PRRS_5-R (5'- TGAAGAGAAGGCATCCAATCAGGTAAG -3'); then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_5-R primers and RACE-F primers and PRRS_5_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→57°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycles→ ...
Embodiment 2
[0021] [Example 2] Construction and verification of AhRRS5 overexpression vector
[0022] AhRRS5 including the stop codon was amplified from a plasmid with a complete reading frame by the primers AhRRS5-OE-F (5'- ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-OE-R (5'- ATTTAGGCGCGCCTACACCTTTGAGAGAGTGCTGCGT-3') The cDNA open reading frame of the gene, with BamH1 and Asc1 restriction sites at the 5′ and 3′ ends, was used simultaneously for the pBI121-GUSA driven by the 2×CaMV 35S promoter constructed in our laboratory and the amplified AhRRS5 target fragment BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) were double digested, the target fragment was recovered, ligated with T4 ligase overnight at 16°C, transformed into E. coli DH5α strain, and p35S::AhRRS5-OE overexpression vector was constructed. After PCR verification and enzyme digestion verification, the correctness of the vector construction was confirmed. The vector diagram is as follows: fig...
Embodiment 3
[0023] [Example 3] Subcellular localization of AhRRS5 gene expression product
[0024] For subcellular localization vectors, amplify from a plasmid with complete reading frame by primers AhRRS5-SL-F (5'-ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-SL-R (5'-ATTAGGCGCGCCACACCTTTGAGAGAGTGCTGCGT-3') Obtain the cDNA of the AhRRS5 gene without the stop codon, with BamH1 and Asc1 restriction sites at the 5′ end and the 3′ end, respectively. The pBI-GFP constructed in this laboratory and the amplified AhRRS5 gene were simultaneously digested with BamH1 and Asc1. , construct p35S::AhRRS5::GFP vector after ligation and transformation. The successfully identified recombinant plasmid was bombarded with a gene gun on the onion epidermis, and after being introduced into the onion epidermis, the plate was placed in a tissue culture room and cultured in the dark for 24-36 hours, so that the GFP fusion protein encoded by the plasmid was fully expressed in the onion epidermis. Then the o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com