NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos

A gene and peanut technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems affecting molecular breeding of peanut resistance to bacterial wilt, and achieve the effect of improving bacterial wilt resistance and important application value

Inactive Publication Date: 2015-04-01
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The molecular biological mechanism of peanut bacterial wilt has not been studied,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos
  • NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos
  • NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0019] [Example 1] RACE acquisition AhRRS5 Gene 3' unknown sequence and 5' unknown sequence

[0020]According to the transcripts of peanut abiotic and biotic stress 454 sequencing, the expression profile gene chip of peanut (synthesized by Roche) was used to screen the differential expression of genes before and after induction by R. Design a pair of gene primers PRRS_5_F (5'- GCTTTGTAGAGGCAAATCAAGGCTG -3') and PRRS_5-R (5'- TGAAGAGAAGGCATCCAATCAGGTAAG -3'); then according to the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_5-R primer and RACE-F primer and PRRS_5_F primer and RACE-R primer paired for 5' and 3'-RACE reactions, respectively, 5'- RACE reaction conditions are 94℃ 5min→(94℃ 30s→57℃ 30s→72℃ 2min)30 cycles→72℃ 10min; 3′-RACE reaction conditions are 94℃ 5min→(94℃ 30s→72℃ 2min)5cycles → (94°C 30s→64°C 30s→72°C 2min) 30 cycles→72°C 10min; according to the size of the target band gene predicted...

Example Embodiment

[0021] [Example 2] AhRRS5 Construction and Validation of Overexpression Vectors

[0022] Amplification from the plasmid with the complete reading frame including the stop codon by the primer pair AhRRS5-OE-F (5'- ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-OE-R (5'- ATTTAGGCGCGCCTACACCTTTGAGAGAGTGCTGCGT-3') AhRRS5 The open reading frame of the gene cDNA, with BamH1 and Asc1 restriction sites at the 5' and 3' ends, respectively, was used for the pBI121-GUSA constructed in our laboratory and amplified by the 2×CaMV 35S promoter. AhRRS5 The target fragment was digested with BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) at the same time, and the target fragment was recovered, ligated with T4 ligase overnight at 16°C, and transformed into E. coli DH5α strain to construct p35S::AhRRS5-OE The overexpression vector is verified by PCR and enzyme digestion to confirm the correctness of its vector construction. The vector diagram is as follows figure ...

Example Embodiment

[0023] [Example 3] AhRRS5 Subcellular localization of gene expression products

[0024] For subcellular localization vectors, the primer pair AhRRS5-SL-F (5'-ATTAGGATCCACCATGGCTGAGAGTGCCATAGCCT-3') and AhRRS5-SL-R (5'-ATTAGGCGCGCCACACCTTTGAGAGAGTGCTGCGT-3') was amplified from a plasmid with an intact reading frame get excluding stop password AhRRS5 The gene cDNA, with BamH1 and Asc1 restriction sites at the 5' and 3' ends respectively, was used for the pBI-GFP constructed in our laboratory and the amplified AhRRS5 The gene was digested with BamH1 and Asc1 at the same time, and then ligated and transformed to construct p35S:: AhRRS5 ::GFP vector. The identified recombinant plasmids were bombarded with onion epidermal cells with a gene gun, and after introduction into onion epidermis, the plate was placed in a tissue culture room for 24-36 hours in the dark, so that the GFP fusion protein encoded by the plasmid was fully expressed in onion epidermal cells. Then the onion epi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a gene AhRRS5 associated with bacterial wilt resistance of arachis hypogaea.L, a construction method of an over-expression vector of the gene and an application of the gene AhRRS5 or the over-expression vector to tobacco bacterial wilt resistant gene engineering, belonging to the technical field of plant gene engineering. The gene contains nucleotide sequences shown in SEQ ID No.1. The over-expression vector is constructed to transform tobaccos, and over-expression of the over-expression vector in the tobaccos can conduce to obviously improving the resistance of the transgenic tobaccos to bacterial wilt through ralstonia solanacearum inoculation identification and molecular detection of the transgenic plants, thereby indicating that AhRRS5 plays an important regulating role in responses of the plants to ralstonia solanacearum infection, which has important significance in bacterial wilt resistant gene engineering breeding application of the plants and strongly promotes the development and application of the tobacco bacterial wilt resistant gene engineering.

Description

technical field [0001] The invention relates to a peanut bacterial wilt resistance related gene AhRRS5 The construction of the overexpression vector and its application in tobacco bacterial wilt resistance genetic engineering belong to the technical field of plant genetic engineering. Background technique [0002] Plants will be infested by pathogenic organisms such as bacteria, viruses, fungi, and insects during their growth and development. However, due to the complex and long process of biological evolution, plants have formed a complete set of effective defense against disease infection. mechanism. During the interaction between plants and pathogens, some pathogens are prevented from being killed by the plant's first line of defense, some are suppressed by PTI in the plant's innate immune system, but some pathogens maintain the pathogenic bacteria by secreting virulence factors. Toxicity, these virulence factors inhibit PTI, trigger plant susceptibility, and ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00
Inventor 庄伟建张冲陈华邓烨蔡铁城
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap