Peanut AhRRS22 gene and application of peanut AhRRS22 gene in resistance to bacterial wilt of tobacco

A gene and peanut technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problem of unclear plant disease resistance response mechanism, research on signal transduction pathways, and research on molecular mechanism of bacterial wilt resistance in crops is in the primary stage, etc. question

Inactive Publication Date: 2015-04-08
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] With the deepening and development of large-scale sequencing and functional genomics research, more and more molecular mechanisms of plant-pathogen interaction have been elucidated, but research on the molecular mechanism of crop bacterial wilt resistance is still in its infancy
At present, except for Arabidopsis, no bacterial wilt resistance gene has been obtained in important crops, and the disease resistance response mechanism of plants after R. solanacearum infection is still unclear, and the signal transduction pathway involved is not yet thoroughly studied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peanut AhRRS22 gene and application of peanut AhRRS22 gene in resistance to bacterial wilt of tobacco
  • Peanut AhRRS22 gene and application of peanut AhRRS22 gene in resistance to bacterial wilt of tobacco
  • Peanut AhRRS22 gene and application of peanut AhRRS22 gene in resistance to bacterial wilt of tobacco

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] [Example 1] RACE acquisition AhRRS22 Gene 3' Unknown Sequence and 5' Unknown Sequence

[0019] Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_22_F (5'-TGAGGTTGTCTGATCAGAGCACAG-3') and PRRS_22-R (5'-GATCGAATAGTCTCCCCTGTAAGGT-3'); and then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_22-R primers and RACE-F primers and PRRS_22_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→60°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycl...

Embodiment 2

[0020] [Example 2] AhRRS22 Construction and verification of overexpression vector

[0021] The primers AhRRS22-OE-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-OE-R (5'-ATTTAGGCGCGCCTATCTAGCATCGATTAATTCCTTGAC-3') were amplified from a plasmid with a complete reading frame, including the stop codon. AhRRS22 The cDNA open reading frame of the gene, with BamH1 and Asc1 restriction sites at the 5′ end and 3′ end, was used for the pBI121-GUSA driven by the 2×CaMV 35S promoter constructed in our laboratory and the amplified AhRRS22 The target fragment was double digested with BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) at the same time, the target fragment was recovered, ligated with T4 ligase overnight at 16°C, transformed into E. coli DH5α strain, and p35S::AhRRS22-OE was constructed The overexpression vector has been verified by PCR and enzyme digestion to confirm the correctness of its vector construction. The vector diagram is as follows: ...

Embodiment 3

[0022] [Example 3] AhRRS22 Subcellular localization of gene expression products

[0023] For subcellular localization vectors, amplify from a plasmid with complete reading frame by primers AhRRS22-SL-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-SL-R (5'-ATTTAGGCGCGCCATCTAGCATCGATTAATTCCTTGAC-3') get excluding the kill password AhRRS22Gene cDNA, with BamH1 and Asc1 restriction sites at the 5' end and 3' end respectively, for the pBI-GFP constructed in our laboratory and the amplified AhRRS22 The gene was double digested with BamH1 and Asc1 at the same time, and p35S was constructed after ligation and transformation:: AhRRS22 ::GFP vector. Agrobacterium GV3101 was transformed by liquid nitrogen freeze-thaw method, and p35S::GFP was used as a control, and Agrobacterium infiltration method was used to transform Nicotiana benthamiana. After culturing at 25°C for 48 hours, the green fluorescence was observed with a fluorescence microscope (the wavelength of excitation lig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a peanut bacterial wilt resistance-related gene AhRRS22, construction of an overexpression vector of the peanut bacterial wilt resistance-related gene AhRRS22 and application of the peanut bacterial wilt resistance-related gene AhRRS22 in tobacco bacterial wilt resistance genetic engineering, and belongs to the technical field of plant genetic engineering. The peanut resistance gene AhRRS22 contains a nucleotide sequence shown in SEQ ID No.1. An AhRRS22 gene plant expression vector is driven by constructing a CaMV 35S promoter, agrobacterium is transformed, the transformed agrobacterium is introduced into tobacco Cuibi-1 by adopting a leaf disc method, ralstonia solanacearum is inoculated to a transgenic tobacco, and then, resistance identification is carried out on the transgenic tobacco, so that a result shows that bacterial wilt resistance of the transgenic tobacco is improved. Therefore, the AhRRS22 gene has a very important application value in plant bacterial wilt resistance genetic engineering.

Description

technical field [0001] The invention relates to a peanut bacterial wilt resistance related gene AhRRS22 The construction of the overexpression vector and its application in tobacco bacterial wilt resistance genetic engineering belong to the technical field of plant genetic engineering. Background technique [0002] peanut( Arachis hypogaea L.) is an important economic crop for both oil and food in the world. Peanut bacterial wilt is an important disease affecting peanut production. It mainly causes serious damage in the Yangtze River Basin and southern regions. It is a disease that must be inspected for peanut varieties. In recent years, it has been found that peanut bacterial wilt has a tendency to spread northward, and bacterial wilt has been reported in Henan and Shandong (Pang Zhenfeng, 2009). Peanut bacterial wilt usually causes 10%-30% yield reduction, and in severe cases it can cause more than 50% or even no harvest. At present, there is no effective chem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N15/66
Inventor张冲庄伟建陈华邓烨蔡铁城
OwnerFUJIAN AGRI & FORESTRY UNIV