Peanut AhRRS22 gene and application of peanut AhRRS22 gene in resistance to bacterial wilt of tobacco
A gene and peanut technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problem of unclear plant disease resistance response mechanism, research on signal transduction pathways, and research on molecular mechanism of bacterial wilt resistance in crops is in the primary stage, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] [Example 1] RACE acquisition AhRRS22 Gene 3' Unknown Sequence and 5' Unknown Sequence
[0019] Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_22_F (5'-TGAGGTTGTCTGATCAGAGCACAG-3') and PRRS_22-R (5'-GATCGAATAGTCTCCCCTGTAAGGT-3'); and then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_22-R primers and RACE-F primers and PRRS_22_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→60°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycl...
Embodiment 2
[0020] [Example 2] AhRRS22 Construction and verification of overexpression vector
[0021] The primers AhRRS22-OE-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-OE-R (5'-ATTTAGGCGCGCCTATCTAGCATCGATTAATTCCTTGAC-3') were amplified from a plasmid with a complete reading frame, including the stop codon. AhRRS22 The cDNA open reading frame of the gene, with BamH1 and Asc1 restriction sites at the 5′ end and 3′ end, was used for the pBI121-GUSA driven by the 2×CaMV 35S promoter constructed in our laboratory and the amplified AhRRS22 The target fragment was double digested with BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) at the same time, the target fragment was recovered, ligated with T4 ligase overnight at 16°C, transformed into E. coli DH5α strain, and p35S::AhRRS22-OE was constructed The overexpression vector has been verified by PCR and enzyme digestion to confirm the correctness of its vector construction. The vector diagram is as follows: ...
Embodiment 3
[0022] [Example 3] AhRRS22 Subcellular localization of gene expression products
[0023] For subcellular localization vectors, amplify from a plasmid with complete reading frame by primers AhRRS22-SL-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-SL-R (5'-ATTTAGGCGCGCCATCTAGCATCGATTAATTCCTTGAC-3') get excluding the kill password AhRRS22Gene cDNA, with BamH1 and Asc1 restriction sites at the 5' end and 3' end respectively, for the pBI-GFP constructed in our laboratory and the amplified AhRRS22 The gene was double digested with BamH1 and Asc1 at the same time, and p35S was constructed after ligation and transformation:: AhRRS22 ::GFP vector. Agrobacterium GV3101 was transformed by liquid nitrogen freeze-thaw method, and p35S::GFP was used as a control, and Agrobacterium infiltration method was used to transform Nicotiana benthamiana. After culturing at 25°C for 48 hours, the green fluorescence was observed with a fluorescence microscope (the wavelength of excitation lig...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com