Peanut ahrrs22 gene and its application in tobacco bacterial wilt resistance

A peanut and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of unclear response mechanism of plant disease resistance, research on signal transduction pathways, research on the molecular mechanism of crop bacterial wilt resistance is in its infancy, etc. question

Inactive Publication Date: 2017-03-29
FUJIAN AGRI & FORESTRY UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] With the deepening and development of large-scale sequencing and functional genomics research, more and more molecular mechanisms of plant-pathogen interaction have been elucidated, but research on the molecular mechanism of crop bacterial wilt resistance is still in its infancy
At present, except for Arabidopsis, no bacterial wilt resistance gene has been obtained in important crops, and the disease resistance response mechanism of plants after R. solanacearum infection is still unclear, and the signal transduction pathway involved is not yet thoroughly studied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peanut ahrrs22 gene and its application in tobacco bacterial wilt resistance
  • Peanut ahrrs22 gene and its application in tobacco bacterial wilt resistance
  • Peanut ahrrs22 gene and its application in tobacco bacterial wilt resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] [Example 1] RACE obtains 3' unknown sequence and 5' unknown sequence of AhRRS22 gene

[0019] Based on peanut abiotic and biotic stress 454 sequenced transcripts, the peanut expression profile gene chip (synthesized by Roche Company) was combined, and the candidate gene fragments were obtained by hybridization of the chip hybridization before and after inoculation of R. solanacearum strains before and after induction of R. solanacearum. Design a pair of gene primers PRRS_22_F (5'-TGAGGTTGTCTGATCAGAGCACAG-3') and PRRS_22-R (5'-GATCGAATAGTCTCCCCTGTAAGGT-3'); and then add the linker sequence RACE-F (AAGCAGTGGTATCAACGCAGAGTGGCCAT) and RACE-R (ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'), using PRRS_22-R primers and RACE-F primers and PRRS_22_F primers and RACE-R primers for 5' and 3'- RACE reactions, respectively, 5'- RACE reaction conditions are 94°C 5min→(94°C 30s→60°C 30s→72°C 2min) 30 cycles→72°C 10min; 3′-RACE reaction conditions are 94°C 5min→(94°C 30s→72°C 2min) 5cycles...

Embodiment 2

[0020] [Example 2] Construction and verification of AhRRS22 overexpression vector

[0021] AhRRS22 including the stop codon was amplified from a plasmid with a complete reading frame by the primers AhRRS22-OE-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-OE-R (5'-ATTTAGGCGCGCCTATCTAGCATCGATTAATTCCTTGAC-3') The cDNA open reading frame of the gene, with BamH1 and Asc1 restriction sites at the 5′ and 3′ ends, was used simultaneously for the pBI121-GUSA driven by the 2×CaMV 35S promoter constructed in our laboratory and the amplified AhRRS22 target fragment BamH1 (purchased from NEB Company) and Asc1 (purchased from NEB Company) were double digested, the target fragment was recovered, ligated with T4 ligase overnight at 16°C, transformed into E. coli DH5α strain, and p35S::AhRRS22-OE overexpression vector was constructed. After PCR verification and enzyme digestion verification, the correctness of the vector construction was confirmed. The vector diagram is as follows: fi...

Embodiment 3

[0022] [Example 3] Subcellular localization of AhRRS22 gene expression product

[0023]For subcellular localization vectors, amplify from a plasmid with a complete reading frame by primers AhRRS22-SL-F (5'-ATTAGGATCCATGGCGGAAGCTTGGTTGTG-3') and AhRRS22-SL-R (5'-ATTTAGGCGCGCCATCTAGCATCGATTAATTCCTTGAC-3') Obtain the cDNA of the AhRRS22 gene excluding the stop codon, with BamH1 and Asc1 restriction sites at the 5′ end and the 3′ end respectively. The pBI-GFP constructed in this laboratory and the amplified AhRRS22 gene were simultaneously digested with BamH1 and Asc1. , construct p35S::AhRRS22::GFP vector after ligation and transformation. Agrobacterium GV3101 was transformed by liquid nitrogen freeze-thaw method, and p35S::GFP was used as a control, and Agrobacterium infiltration method was used to transform Nicotiana benthamiana. After culturing at 25°C for 48 hours, the green fluorescence was observed with a fluorescence microscope (the wavelength of excitation light was 488nm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a peanut bacterial wilt resistance-related gene AhRRS22, construction of an overexpression vector of the peanut bacterial wilt resistance-related gene AhRRS22 and application of the peanut bacterial wilt resistance-related gene AhRRS22 in tobacco bacterial wilt resistance genetic engineering, and belongs to the technical field of plant genetic engineering. The peanut resistance gene AhRRS22 contains a nucleotide sequence shown in SEQ ID No.1. An AhRRS22 gene plant expression vector is driven by constructing a CaMV 35S promoter, agrobacterium is transformed, the transformed agrobacterium is introduced into tobacco Cuibi-1 by adopting a leaf disc method, ralstonia solanacearum is inoculated to a transgenic tobacco, and then, resistance identification is carried out on the transgenic tobacco, so that a result shows that bacterial wilt resistance of the transgenic tobacco is improved. Therefore, the AhRRS22 gene has a very important application value in plant bacterial wilt resistance genetic engineering.

Description

technical field [0001] The invention relates to the construction of a peanut bacterial wilt resistance-related gene AhRRS22 and its overexpression vector and its application in tobacco bacterial wilt resistance genetic engineering, belonging to the technical field of plant genetic engineering. Background technique [0002] Peanut (Arachis hypogaea L.) is an important economic crop for both oil and food in the world. Peanut bacterial wilt is an important disease affecting peanut production. It mainly causes serious damage in the Yangtze River Basin and southern regions. It is a disease that must be inspected for peanut varieties. In recent years, it has been found that peanut bacterial wilt has a tendency to spread northward, and bacterial wilt has been reported in Henan and Shandong (Pang Zhenfeng, 2009). Peanut bacterial wilt usually causes 10%-30% yield reduction, and in severe cases it can cause more than 50% or even no harvest. At present, there is no effective chemica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N15/66
Inventor 张冲庄伟建陈华邓烨蔡铁城
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap