Duck plague virus gene deletion transfer vector and application thereof

A technology of duck plague virus and transfer vector, which is applied in the field of genetic engineering and animal virology, can solve the problems of hidden virus, short immune maintenance period, large dose, etc., and achieve high biological safety and good safety effect

Inactive Publication Date: 2015-04-01
QINGDAO VLAND BIOTECH INC
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although inactivated vaccines are safe, they have a short immunization maintenance period, large doses, and high costs; although chicken embryo attenuated vaccines have good immunization effects, they have potential safety hazards such as strong virulence and hidden infection, and are now Some diagnostic methods cannot distinguish between naturally infected wild virus and attenuated vaccine immunized animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Duck plague virus gene deletion transfer vector and application thereof
  • Duck plague virus gene deletion transfer vector and application thereof
  • Duck plague virus gene deletion transfer vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] The construction of embodiment 1 duck plague virus gene deletion transfer vector

[0060] 1. Construction of plasmid pLS-lacZ

[0061] 1.1 Loxp sequence design and synthesis:

[0062] Nde I and Hind III restriction sites are designed at both ends, containing two 34bp Loxp sequences in the same direction (the oblique part):

[0063] CATATG AGATCTGAATTCTCGCGAATAACTTCGTATAATGTATGCTATACGAAGTTATGGATCCGAGCTCGCTAGCGGTACCTCTAGATATCGTCGACATAACTTCGTATAATGTATGCTATACGAAGTTATCTCGAGCTGCAG AAGCTT . The above sequence was connected to Nde I and Hind III sites of pUC57 to construct plasmid pUC-LS.

[0064] 1.2 Acquisition of SV40 promoter and lacZ gene

[0065] Amplify SV40 promoter primers:

[0066] SV40-F:GA AGATCT AAGAACCAGCTGGGGCTCTA

[0067] SV40-R:CCG CTCGAG CGACGGTATACAGACATGAT

[0068] Primers for amplifying the lacZ gene:

[0069] lacZ-F:5′-G CCCGGG ATGATAGATCCCGTCGTTT-3′

[0070] lacZ-R:5′-GC TTCGAA TTATTTCTGACACCCAGACC-3′

[0071] 1.3 Build process

[007...

Embodiment 2

[0115] Embodiment 2 recombinant duck plague virus rDPV / gI - / gE - construction and purification of

[0116] 1. Recombinant duck plague virus rDPV / gI - / gE - / lacZ + construction and purification of

[0117] 1) Preparation of duck plague virus transfer vector pgIE-lacZ

[0118] The pgIE-lacZ transfer vector plasmid was prepared according to the instructions of the Wizard Plus Midipreps DNA Purification System kit, and the concentration and purity of the nucleic acid were determined.

[0119] 2) recombinant duck plague virus rDPV / gI - / gE - / lacZ + build

[0120]Primary chicken embryo fibroblast (CEF) cells were prepared according to conventional methods, cultured in a six-well cell culture plate to a dense monolayer of 80%, inoculated with duck plague virus strain, and treated at 37° C. for 2 h. During virus incubation, prepare solution 1 according to the ratio of 150uL serum-free OPTI-MEM and 8uL Lipofectamine 2000 per well, mix gently, then add 150uL serum-free OPTI...

Embodiment 3

[0142] Embodiment 3 recombinant duck plague virus rDPV / gI - / gE - Immunological experiments

[0143] recombinant duck plague virus rDPV / gI - / gE - to 10 3 EID 50 1 mL of 4-week-old ducklings was inoculated with the attenuated vaccine strain DPV AV1222 (10 3 EID 50 ), PBS (1mL) as a control, 10 in each group, observed clinical symptoms, monitored for 4 weeks, and collected duck serum at 7, 14, 21 and 28 days after immunization. After inactivation treatment of duck serum, do gradient dilution according to 1:40, 1:80, 1:160, 1:320, 1:640, respectively with duck plague virus (AV1222 strain E 52 Generation virus (the 52nd generation virus of chicken embryo breeding)) carries out equal volume mixing, with containing 100 ELD 50 / 0.2mL as the neutralizing dose, the mixture was incubated at 37°C for 30min, inoculated with 9-day-old duck embryos, 5 duck embryos in each group, 0.2mL each, cultured at 37°C, and the culture results were recorded after 6 days. Antibody levels were ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims at providing a duck plague virus gene deletion transfer vector and an application of the duck plague virus gene deletion transfer vector. The transfer vector is subjected to homologous recombination with duck plague virus to obtain duck plague virus gene deletion engineering strains which can be prepared into a high-safety and high-prevention-effect duck plague virus gene deletion vaccine. The duck plague virus gene deletion vaccine does not influence the virus immunogenicity while lowering down the virus pathogenicity; therefore, the prepared duck plague virus gene deletion vaccines are high in safety, able to remain the original virus immunogenicity, suitable for prevention and control for the current duck plague diseases in domestic, and beneficial for the cleaning treatment of duck plague in a duck farm; in addition, the recombined duck plague virus strains do not contain any exogenous genes; and compared with the similar duck plague virus gene vaccines reported in the prior art, the duck plague virus gene deletion vaccine has the advantage that no EGFP (Enhanced Green Fluorescent Protein), lacZ and other marker gene are contained, so that the bio-safety is improved.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and animal virology, and in particular relates to a duck plague virus gene deletion transfer carrier and application thereof. Background technique [0002] Duck plague virus (DPV) is one of the main viruses that seriously threaten the duck industry in my country. In 2013, the International Committee on Taxonomy of Viruses (ICTV) reclassified duck plague virus and classified it as Marek virus of the order Herpesvirales (Herpesvirales) α-herpesvirinae (Alphaherpesvirinae) The genus (Mardivirus) (http: / / ictvonline.org / virusTaxonomy.asp) taxonomic name is "Anatid herpesviurs 1 (AnHV-1, duck herpes virus type 1). Duck plague virus is a pantropic systemic infection virus , mainly causing acute contact infectious diseases of Anseriformes waterfowl such as ducks, geese, and swans. Under natural conditions, it causes a large number of ducks to become ill and die. Ducks of different ages and sex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/66C12N7/00A61K39/245A61P31/22C12R1/93
CPCY02A50/30
Inventor赵怀龙凌红丽韩成昊张园园
OwnerQINGDAO VLAND BIOTECH INC