Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof
A technology mediated by Agrobacterium and smut bacteria, applied in biochemical equipment and methods, botany equipment and methods, applications, etc., can solve the problems of cumbersome operation, low transformation efficiency, poor repeatability, etc., and achieve simple source of receptors , high conversion efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 carrier system construction
[0054] Plant expression vectors generally cannot be directly used in fungi, because usually the promoters required for plant gene expression have problems in terms of their efficiency and expression stability in fungi. At present, there are few vectors that can be directly used in fungi, so the present invention transforms the plant pCAMBIA1301 expression vector to transgene the Zizania smut. The main transformation of the vector is firstly, replacing the 35S promoter in the plant expression vector with the gpda promoter and hsp70 promoter from Aspergillus nidulans; secondly, inserting the sGFP reporter gene suitable for the fungal system to facilitate subsequent expression detection; thirdly, providing multiple For antibiotic selection, the present invention mainly includes the hygromycin resistance gene hyg, which can be effectively screened with hygromycin, and the neomycin phosphotransferase II site, which can be screened wi...
Embodiment 2
[0061] Embodiment 2 Carrier system construction
[0062] We also used the pPK2 vector different from pCAMBIA1301 as the backbone, by Infusion The homologous recombination method (that is, Clontech's In-Fusion technology can complete clonal recombination as long as the end of the inserted DNA fragment has 15 homologous base sequences with the end of the vector) inserts various target fragments to construct the required expression vector. Specific steps are as follows:
[0063] 1) Use the pCAMBIA1301 constructed fungal expression vector to amplify the EcoRI-Pgpda-SacI-GFP-PstI-Ttrpc-HindIII fragment with high-fidelity Taq enzyme (primers used are PgpdaF02: GAATTCCGGAGAATATGGAGCTTCATCG, TtrpcR: AAGCTTTCGAGTGGAGATGTGGAGTG), the fragment Can be combined with pmd-19 T simple carrier as an intermediate carrier, marked as T-P gpda -sgfp;
[0064] 2) For the fungal promoter to be replaced, such as the heat shock protein promoter Phsp70, the carbon source-controlled promoter P fr...
Embodiment 3
[0070] Example 3 Agrobacterium system preparation
[0071] 1. Preparation of Competent State
[0072] (1) Streak the glycerol strain (GV3101 or EHA105) stored at -80°C on an LB (50mg / LRif) plate, and culture and activate overnight at 28°C;
[0073] (2) Select the single clone on the plate, transfer it to a 5ml LB (50mg / L Rif) tube and shake the bacteria overnight;
[0074] (3) Transfer 5ml of the small shaker solution to a 100ml LB shaker bottle, shake and culture at 250rpm at 28°C for 4-5 hours, and measure the OD of the bacteria solution regularly 600 Value, measured every 30min after culturing for 2 hours, when OD 600 When the value reaches 0.3-0.4, take out the shaker flask from the shaker and place it on ice to fully cool (usually about 30 minutes);
[0075] (4) The bacterial solution was transferred to a pre-cooled 50ml centrifuge tube, and centrifuged at 4°C and below 4000g for 15 minutes. Carefully pour off the supernatant, wash the resuspended bacteria with 20ml p...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com