Check patentability & draft patents in minutes with Patsnap Eureka AI!

Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof

A technology mediated by Agrobacterium and smut bacteria, applied in biochemical equipment and methods, botany equipment and methods, applications, etc., can solve the problems of cumbersome operation, low transformation efficiency, poor repeatability, etc., and achieve simple source of receptors , high conversion efficiency

Inactive Publication Date: 2015-04-29
ZHEJIANG FORESTRY ACAD +1
View PDF0 Cites 58 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process of protoplast preparation and regeneration is complex and poorly reproducible, which causes PEG-CaC1 2 The method is cumbersome to operate and the conversion efficiency is low
Although electroporation and biolistic methods can use conidia as receptors, the transformation efficiency of these methods is also very low
REMI is a technology that randomly inserts linearized plasmid DNA into the genome DNA of an organism to generate insertion mutations, but 30%-50% of the mutants produced by this technology are not caused by insertion mutations, and the false positives are high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof
  • Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof
  • Agrobacterium-mediated ustilago esculenta transformant strain as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 carrier system construction

[0054] Plant expression vectors generally cannot be directly used in fungi, because usually the promoters required for plant gene expression have problems in terms of their efficiency and expression stability in fungi. At present, there are few vectors that can be directly used in fungi, so the present invention transforms the plant pCAMBIA1301 expression vector to transgene the Zizania smut. The main transformation of the vector is firstly, replacing the 35S promoter in the plant expression vector with the gpda promoter and hsp70 promoter from Aspergillus nidulans; secondly, inserting the sGFP reporter gene suitable for the fungal system to facilitate subsequent expression detection; thirdly, providing multiple For antibiotic selection, the present invention mainly includes the hygromycin resistance gene hyg, which can be effectively screened with hygromycin, and the neomycin phosphotransferase II site, which can be screened wi...

Embodiment 2

[0061] Embodiment 2 Carrier system construction

[0062] We also used the pPK2 vector different from pCAMBIA1301 as the backbone, by Infusion The homologous recombination method (that is, Clontech's In-Fusion technology can complete clonal recombination as long as the end of the inserted DNA fragment has 15 homologous base sequences with the end of the vector) inserts various target fragments to construct the required expression vector. Specific steps are as follows:

[0063] 1) Use the pCAMBIA1301 constructed fungal expression vector to amplify the EcoRI-Pgpda-SacI-GFP-PstI-Ttrpc-HindIII fragment with high-fidelity Taq enzyme (primers used are PgpdaF02: GAATTCCGGAGAATATGGAGCTTCATCG, TtrpcR: AAGCTTTCGAGTGGAGATGTGGAGTG), the fragment Can be combined with pmd-19 T simple carrier as an intermediate carrier, marked as T-P gpda -sgfp;

[0064] 2) For the fungal promoter to be replaced, such as the heat shock protein promoter Phsp70, the carbon source-controlled promoter P fr...

Embodiment 3

[0070] Example 3 Agrobacterium system preparation

[0071] 1. Preparation of Competent State

[0072] (1) Streak the glycerol strain (GV3101 or EHA105) stored at -80°C on an LB (50mg / LRif) plate, and culture and activate overnight at 28°C;

[0073] (2) Select the single clone on the plate, transfer it to a 5ml LB (50mg / L Rif) tube and shake the bacteria overnight;

[0074] (3) Transfer 5ml of the small shaker solution to a 100ml LB shaker bottle, shake and culture at 250rpm at 28°C for 4-5 hours, and measure the OD of the bacteria solution regularly 600 Value, measured every 30min after culturing for 2 hours, when OD 600 When the value reaches 0.3-0.4, take out the shaker flask from the shaker and place it on ice to fully cool (usually about 30 minutes);

[0075] (4) The bacterial solution was transferred to a pre-cooled 50ml centrifuge tube, and centrifuged at 4°C and below 4000g for 15 minutes. Carefully pour off the supernatant, wash the resuspended bacteria with 20ml p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biology breeding and in particular relates to an agrobacterium-mediated ustilago esculenta (Ustilago esculenta) transformant strain as well as a preparation method and application thereof. According to the agrobacterium-mediated ustilago esculenta transformant strain, an agrobacterium infected receptor of the transformant strain refers to ustilago esculenta (Ustilago esculenta). The method for preparing the agrobacterium-mediated ustilago esculenta transformant strain comprises the following steps: (1) preparing a fungal expression vector; (2) preparing agrobacterium competence; (3) performing electrotransformation on the agrobacterium; and (4) performing agrobacterium-mediated transformation, thereby obtaining the transformant. A complex protoplast is not needed, the receptor source is simple, and spores and hypha of the fungi can be directly used for transformation; and the transformation efficiency is high. In addition, the obtained transformant is large in single-copy ratio, and marker genes are conveniently obtained.

Description

technical field [0001] The invention relates to the field of biological breeding, in particular to an Agrobacterium-mediated Zizania smut ( Ustilago esculenta ) transformant strain and its preparation method and application. Background technique [0002] Zizania is a unique aquatic vegetable in my country, which is planted in most provinces of my country, and the economic benefits of production are very high. Zizania as a vegetable is mainly influenced by Zizania smut ( Ustilago esculenta ) infects and expands into a fleshy stem. Existing studies have shown that in nature, the frequency of plant budding is very low, while Zizania can isolate many large stable variations in a small population. Therefore, although the current mechanism of smut infection It has not been fully elucidated, but it can be speculated that the variation of Zizania stems mainly not from the budding of Zizania plants, but from the genetic variation of Zizania smut. [0003] It is generally believed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/66C12Q1/68C12Q1/04C12R1/645
CPCA01H5/00C12N1/14C12N15/66C12N15/80C12Q1/04C12N1/145C12R2001/645
Inventor 彭华正韩凝金群英边红武朱汤军钱佳
Owner ZHEJIANG FORESTRY ACAD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More