Agrobacterium tumefacien mediated genetic transformation method for ustilago esculenta
A genetic transformation method, the technology of Agrobacterium tumefaciens, applied in the directions of microorganism-based methods, biochemical equipment and methods, introduction of foreign genetic material using vectors, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Obtainment of T-DNA Insertion Transformants of Zizania smut
[0025] Preparation of Zizania spores
[0026] After cultivating the Zizania smut fungus on YePSA solid medium (yeast extraction 1%, peptide 2%, sugar 2%, agar 2%) for 2 days, inoculate the Zizania smut fungus into YePS liquid medium (yeast extraction 1%, peptone 2 %, sugar 2%), shaker 200rpm, culture for 2 days, then centrifuge at 5000rpm to collect the bacteria, add ddH 2 O 2 Make 1×10 7 Pcs / mL spore suspension ( figure 1 )), to obtain a spore suspension of Zizania spp. for use. All the above operations are carried out under sterile conditions.
[0027] Preparation of carrier Agrobacterium
[0028] Using plasmids pEX2-eGFP and pEX2-RFP as transformation vectors, the pEX2-eGFP vector carries the green fluorescent protein gene eGFP and the hygromycin resistance screening gene hph( figure 2 A), pEX2-RFP vector carries red fluorescent protein gene RFP and hygromycin resistance screening gene hph( figure 2...
Embodiment 2
[0032] Example 2 Identification of Zizania smutella transformants
[0033] 1) Fluorescence microscope identification
[0034] Place the conidia of Zizania smutella transformants under a fluorescence microscope to observe the fluorescence. No fluorescence signal was detected in the wild-type Zizania spp., the transformant transformed by Agrobacterium emits green or red light under the excitation light of the fluorescence microscope, which proves that the green fluorescent protein GFP and red fluorescent protein RFP of Agrobacterium have been successfully transferred. And expressed in Zizania smut ( image 3 ).
[0035] 2) PCR verification of Zizania smutella transformants
[0036] Design primer hph-F: ATGAAAAAGCCTGAACTCACCGC (SEQ.ID.No.2) / hph- using the hygromycin gene (hph(SEQ.ID.No.1)) on the binary vector pEX2-eGFP and pEX2-RFP as a template. R: GCTGCTCCATACAAGCCAACCAC (SEQ. ID. No. 3) PCR amplification was performed on the transformant (the length of the amplified product was abo...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com