Supercharge Your Innovation With Domain-Expert AI Agents!

Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control

A gypsy moth and gene technology, which is applied to the application field in the control of Asian gypsy moth to achieve the effect of improving sensitivity

Inactive Publication Date: 2015-04-29
NORTHEAST FORESTRY UNIVERSITY
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is no report about controlling the important forest pest gypsy moth and improving its sensitivity to the organophosphorus pesticide omethoate by inhibiting the transcription level of cytochrome P450 CYP6AN15v1 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control
  • Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control
  • Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 : Gypsy moth cytochrome CYP6 AN15v1 Gene full-length cloning

[0024] The gypsy moth cytochrome CYP6 AN15v1 gene has a nucleic acid sequence of 2224 bp (SEQ ID No.1), an open reading frame of 1536 bp, encoding 512 amino acids (sequence shown in SEQ ID No.2), a molecular weight of 59.02 kDa, and a theoretical isoelectric Point PI is 9.03, which is a basic protein.

[0025] Total RNA was extracted from Gypsy moth, using the reverse transcription kit PrimeScript TM RT reagent Kit (TaKaRa) synthesized the first strand of cDNA, and then used the first strand of cDNA as a template to design primers on both sides of the gene coding region sequence according to the transcriptome sequence of gypsy moth larvae (forward primer: 5'- ATGTTCGCTCTATTACTACTGTTTCTACTACTATTAG -3 '; reverse primer: 5'- TTTCCTCAGCTTCAGTCTAACAGGTAGACC-3'). Reaction system: 5×PrimeScript buffer 2 μL, PrimeScript RT Enzyme Mix I 0.5 μL, Oligo d(T) primer (50 μM) 0.5 μL, Random 6 mers (100...

Embodiment 2

[0026] Example 2 : Gypsy moth CYP6 AN15v1 Gene dsRNA Synthesis

[0027]According to the full length of the gypsy moth CYP6AN15v1 gene cloned in Example 1, design and synthesize CYP6AN15v1 gene dsRNA forward primer Ld CYP6AN15v1F: (5'- ATGTTCGCTCTATTACTACTGTTTCTACTACTATTAG -3') and reverse primer Ld CYP6AN15v1R: (5'- TTTCCTCAGCTTCAGTCTAACAGGTAGACC -3' ), amplified to obtain a sequence with a fragment length of 599 bp, and obtained the dsRNA of the CYP6 AN15v1 gene through an in vitro dsRNA synthesis kit.

[0028] The specific synthesis process is that a 20 bp T7 promoter sequence is added to the 5' end of each specific primer, and GFP is used as a control group. The target band was amplified by PCR method, and the reaction program was: 94°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 7 min, and the amplified product was confirmed by electrophoresis. Synthesize dsRNA as a template (refer to the MEGAscript RNAi Kit kit instruction ma...

Embodiment 3

[0029] Example 3 : Gypsy moth CYP6AN15v1 Detection of gene silencing effects

[0030] The dsRNA (1 μg) of the CYP6AN15v1 gene and GFP gene synthesized in Example 2 was microinjected into the 3rd instar larvae of the gypsy moth, and the active 3rd instar larvae were selected at 6h, 1d, 4d and 6d respectively, and the total RNA of the animal tissue was used to obtain the RNeasy Mini Extraction kit (Qiagen) to extract total RNA, using PrimeScript TM The first strand of cDNA was synthesized by RT kit (TaKaRa) and used as a template to detect the expression of CYP6AN15v1 gene after injection by fluorescent quantitative RT-PCR. The injection of exogenous gene GFP dsRNA was used as a control. The results of the study showed that the relative expression of CYP6AN15v1 in the CYP6AN15v1dsRNA treatment group was significantly stress-induced up-regulated at 6 h after injection, which was the ddH 2 13.45 times that of the O control group and 4.16 times that of the GFP dsRNA contr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control. The dsRNA sequence is shown by SEQ ID NO.3, and can be applied to regulation and control of the growth and development of lymantria dispar linnaeus or improvement of the sensitivity of the lymantria dispar linnaeus to an organic phosphorus insecticide. An experimental result shows that the weight increasing amount in a CYP6AN15v1 gene silenced lymantria dispar linnaeus larva 8d is smaller than contrast ddH2O but higher than that of GFP, and the weight increasing amounts of 1-6ds are smaller than that of GFPdsRNA and that of a ddH2O treatment group, so that the nutritional utilization index of the lymantria dispar Linnaeus is significantly influenced, and the food conversion rate and food utilization rate are significantly smaller than those of a contrast (P is less than 0.05); the dsRNA can efficiently and specifically silence the expression of mRNA of the CYP6AN15v1 gene in the body of lymantria dispar Linnaeus; and the sensitivity of the lymantria dispar linnaeus larva to the organic phosphorus insecticide is significantly improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a cytochrome P450 gene CYP6AN15v1dsRNA of Asian gypsy moth and its application in preventing and treating Asian gypsy moth. Background technique [0002] According to foreign reports, the gypsy moth ( Lymantria dispar Linnaeus) can harm more than 300 kinds of plants, domestic reports can harm more than 500 kinds of plants such as poplar, willow, apple, sylvestris pine, and larch. The gypsy moth spreads quickly, has a large amount of reproduction and food intake, and causes significant economic losses to forestry production. At present, the control of Asian gypsy moth is still dominated by chemical insecticides. Although the control effect is remarkable, these compounds are easy to cause "3R" problems that cannot be ignored. Although some natural enemies of pests, pathogenic microorganisms and other biological control methods play a certain role in the control of gypsy m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/89A01N57/16A01P7/04
Inventor 曹传旺高彩球孙丽丽王超张健吴韶平
Owner NORTHEAST FORESTRY UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More