Lymantria dispar linnaeus CYP6AN15v1 gene dsRNA and application thereof in nuisanceless control
A gypsy moth and gene technology, which is applied to the application field in the control of Asian gypsy moth to achieve the effect of improving sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 : Gypsy moth cytochrome CYP6 AN15v1 Gene full-length cloning
[0024] The gypsy moth cytochrome CYP6 AN15v1 gene has a nucleic acid sequence of 2224 bp (SEQ ID No.1), an open reading frame of 1536 bp, encoding 512 amino acids (sequence shown in SEQ ID No.2), a molecular weight of 59.02 kDa, and a theoretical isoelectric Point PI is 9.03, which is a basic protein.
[0025] Total RNA was extracted from Gypsy moth, using the reverse transcription kit PrimeScript TM RT reagent Kit (TaKaRa) synthesized the first strand of cDNA, and then used the first strand of cDNA as a template to design primers on both sides of the gene coding region sequence according to the transcriptome sequence of gypsy moth larvae (forward primer: 5'- ATGTTCGCTCTATTACTACTGTTTCTACTACTATTAG -3 '; reverse primer: 5'- TTTCCTCAGCTTCAGTCTAACAGGTAGACC-3'). Reaction system: 5×PrimeScript buffer 2 μL, PrimeScript RT Enzyme Mix I 0.5 μL, Oligo d(T) primer (50 μM) 0.5 μL, Random 6 mers (100...
Embodiment 2
[0026] Example 2 : Gypsy moth CYP6 AN15v1 Gene dsRNA Synthesis
[0027]According to the full length of the gypsy moth CYP6AN15v1 gene cloned in Example 1, design and synthesize CYP6AN15v1 gene dsRNA forward primer Ld CYP6AN15v1F: (5'- ATGTTCGCTCTATTACTACTGTTTCTACTACTATTAG -3') and reverse primer Ld CYP6AN15v1R: (5'- TTTCCTCAGCTTCAGTCTAACAGGTAGACC -3' ), amplified to obtain a sequence with a fragment length of 599 bp, and obtained the dsRNA of the CYP6 AN15v1 gene through an in vitro dsRNA synthesis kit.
[0028] The specific synthesis process is that a 20 bp T7 promoter sequence is added to the 5' end of each specific primer, and GFP is used as a control group. The target band was amplified by PCR method, and the reaction program was: 94°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 7 min, and the amplified product was confirmed by electrophoresis. Synthesize dsRNA as a template (refer to the MEGAscript RNAi Kit kit instruction ma...
Embodiment 3
[0029] Example 3 : Gypsy moth CYP6AN15v1 Detection of gene silencing effects
[0030] The dsRNA (1 μg) of the CYP6AN15v1 gene and GFP gene synthesized in Example 2 was microinjected into the 3rd instar larvae of the gypsy moth, and the active 3rd instar larvae were selected at 6h, 1d, 4d and 6d respectively, and the total RNA of the animal tissue was used to obtain the RNeasy Mini Extraction kit (Qiagen) to extract total RNA, using PrimeScript TM The first strand of cDNA was synthesized by RT kit (TaKaRa) and used as a template to detect the expression of CYP6AN15v1 gene after injection by fluorescent quantitative RT-PCR. The injection of exogenous gene GFP dsRNA was used as a control. The results of the study showed that the relative expression of CYP6AN15v1 in the CYP6AN15v1dsRNA treatment group was significantly stress-induced up-regulated at 6 h after injection, which was the ddH 2 13.45 times that of the O control group and 4.16 times that of the GFP dsRNA contr...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 