Unlock instant, AI-driven research and patent intelligence for your innovation.

Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof

An expression vector, a technology for Saccharomyces cerevisiae, which is applied in the field of construction of Saccharomyces cerevisiae expression vectors, can solve the problems of complex pathway construction, low expression efficiency, genetic instability, etc., and achieve the effect of gene integration

Inactive Publication Date: 2015-04-29
ZHEJIANG UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to overcome the shortcomings of current Saccharomyces cerevisiae expression vectors in the assembly of multi-gene metabolic pathways, such as genetic instability, low expression efficiency, complicated pathway construction, and dependence on auxotrophic markers, and provide a recyclable selectable marker Method for constructing integrated expression vector of Saccharomyces cerevisiae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof
  • Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof
  • Brewing yeast integrated expression vector with recyclable selective marker and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: Construction of PUMRI-21 model plasmid

[0042] 1) The loxp-KanMX-URA-PBR322 replicon-Loxp segment was synthesized by DNA chemical synthesis method, as shown in SEQ ID NO:1. The sequence contains two optimally designed loxp, G418 resistance expression cassette, Saccharomyces cerevisiae URA3 expression cassette, and PBR322 replication origin.

[0043] 2) Using primers ADH1tF2 and CYC1tR2 to amplify the double expression cassette segment (total 1351bp) from the commercialized vector PESC-URA (GenBank: AF063585.2) and perform gel recovery. Its primer sequence is as follows:

[0044] ADH1tF2:

[0045] CACTAAAGGGAACAAAAGCTGGAGCTGGCCTTGTAGGCCTCTTCGCTATTACGCC (SEQ ID NO: 2)

[0046] CYC1tR2:

[0047] GACTCACTATAGGGCGAATTGGGATCTTCGAGCGTCCCAA (SEQ ID NO: 3)

[0048] The PCR system is: total system 25ul, including 16.25μl of water, 5μl of buffer, 2μl of dNTPs, 0.5μl of genome, 0.5μl of each primer, and 0.25μl of Primer Star DNA polymerase.

[0049] The PCR progr...

Embodiment 2

[0054] Example 2: The selectable marker of PUMRI-21 model plasmid can be recycled and characterized

[0055] 1) Construction of homology arm HA-DPP1

[0056] Firstly, the genome of Saccharomyces cerevisiae strain BY4741 was extracted according to conventional operations; then, PCR was performed using DPP1-UPF1 and DPP1-UPR1, DPP1-DF1 and DPP1-DR1 as templates, respectively, using the extracted genomes as templates. The primer sequences are as follows:

[0057] DPP1-UPF1: CCATCAGGCCTTTATGGCCGCATTATGTCCGATAAACACAG (SEQ ID NO: 6)

[0058] DPP1-UPR1: GAACAAAAGCTGGAGCTGGCCTTGTCAACCGATCGACAAATTATTTC (SEQ ID NO: 7)

[0059] DPP1-DF1: GGCGTAATAGCGAAGAGGCCTACAGAAGGCTTGCCATTGGACAC (SEQ ID NO: 8)

[0060] DPP1-DR1: CATAATGCGGCcataaagGCCTGATGGGTGACTGCTTCCTC (SEQ ID NO: 9)

[0061] The PCR system is: 25 μl of the total system, including 16.25 μl of water, 5 μl of buffer, 2 μl of dNTPs, 0.5 μl of genome, 0.5 μl of each primer, and 0.25 μl of Primer Star DNA polymerase.

[0062] The PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a brewing yeast integrated expression vector with a recyclable selective marker as well as a construction method and application thereof. The Brewing yeast integrated expression vector with the recyclable selective marker comprises a loxp-KanMX-URA-PBR322 replicon-Loxp (SEQ ID NO:1), a yeast primary expression cassette and a homologous arm insertable section, wherein the yeast primary expression cassette is any one of a yeast promoter, a multiple cloning site and a transcription terminator. According to the brewing yeast integrated plasmid, replacement of an expression cassette element, cloning of a foreign gene in escherichia coli, integration and screening of the gene in yeast, rapid, simple and convenient removal of the selective marker and recycling of the tool can be realized. According to the invention, removal of the selective marker is represented and verified; the brewing yeast integrated expression vector can be widely applied to long-way multi-gene integration of brewing yeast.

Description

technical field [0001] The invention relates to the fields of genetic engineering and metabolic engineering. Specifically, the present invention relates to a method for constructing a Saccharomyces cerevisiae expression vector with recyclable selectable markers, which can be widely applied to the integration of longer pathway polygenes in Saccharomyces cerevisiae. Background technique [0002] Due to the excellent characteristics of Saccharomyces cerevisiae in terms of physiology and biochemistry, high-density fermentation, and genetic manipulation, many studies have chosen Saccharomyces cerevisiae as the host strain to introduce exogenous metabolic pathways into Saccharomyces cerevisiae cells for the biosynthesis of high value-added compounds . However, constructing a stable genetic multigene metabolic pathway in Saccharomyces cerevisiae remains a major challenge in metabolic engineering. [0003] At present, the overexpression of genes in Saccharomyces cerevisiae mainly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/66C12R1/865
Inventor 于洪巍吕小妹谢文平叶丽丹
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More