Bivalent DNA vaccine and its enteric-coated preparation for preventing giardiasis

A DNA vaccine, giardiasis technology, applied in the field of vaccines, can solve problems such as the difficulty in ensuring the amount of animal feed, achieve the effect of easy large-scale production, overcome the single effect of vaccines, and have good application prospects

Inactive Publication Date: 2017-01-04
JINLIN MEDICAL COLLEGE
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the common problem of various veterinary vaccines through bait or feed feeding route is that it is difficult to guarantee the amount of animal feeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bivalent DNA vaccine and its enteric-coated preparation for preventing giardiasis
  • Bivalent DNA vaccine and its enteric-coated preparation for preventing giardiasis
  • Bivalent DNA vaccine and its enteric-coated preparation for preventing giardiasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Construction and Identification of Recombinant Prokaryotic Expression Vectors pET41a-α1-giardin and pET41a-CWP-2

[0055] (1) According to the gene sequencing of α1-giardin in the Genbank database, specific primers were designed and synthesized, and HindⅢ and EcoRI restriction sites were introduced at both ends of the sequence, and the protective base GC was introduced at both ends of the restriction site.

[0056] Primers for α1-giardin:

[0057] α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)

[0058] α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)

[0059] (2) According to the gene sequence of Giardia CWP2 in the Genbank database, the antigenic epitope encoded by it was analyzed, and an epitope containing 125 amino acids was screened out. Design specific primers, introduce HindⅢ and EcoRI restriction sites at both ends of the sequence, and introduce protective base GC at both ends of the restriction sites.

[0060] Primers for CWP-2:

[0061] Gl-CWP2-F5:CC AAGCTT A...

Embodiment 2

[0067] Massive expression and purification of recombinant α1-giardin and CWP-2 in Escherichia coli, preparation of specific antibodies

[0068] (1) Extended expression system: Pick a single colony from the plates of pET41a-α1-giardin / BL21 and pET41a-CWP-2 / BL21 and put it into 50 ml of LB culture medium containing kanamycin. 37°C, 200rpm, shaking culture overnight; the next day, take 25ml of the overnight cultured bacterial solution and inoculate two 4L Erlenmeyer flasks containing 1L LB (containing 30μg / ml kanamycin). 37°C, 250rpm, rapid shaking culture to OD600≈0.6. Add IPTG to a final concentration of 1 mM, induce expression at 30°C, 250 rpm for 5 hours; collect the bacterial pellet by centrifugation, ultrasonically lyse, collect the supernatant (soluble expression), and use His-tag affinity chromatography column to purify the target protein.

[0069] (2) Preparation of specific polyclonal antibody: Take 20 BALB / c female mice aged 6-8 weeks, respectively use 20 μg / 0.1ml of ...

Embodiment 3

[0071] Construction of recombinant plasmids pVAX1-α1-giardin and pVAX1-CWP-2

[0072] (1) According to the gene sequencing of α1-giardin in the Genbank database, specific primers were designed and synthesized, and HindⅢ and EcoRI restriction sites were introduced at both ends of the sequence, and the protective base GC was introduced at both ends of the restriction site.

[0073] Primers for α1-giardin:

[0074] α1-G-F1:CC AAGCTT ATGCCGAAGGTCACCGACAT(HindIII)

[0075] α1-G-R2:CG GGATCC CTTCACGCGCCAGAGGGTGC(BamHI)

[0076] (2) According to the gene sequence of Giardia CWP2 in the Genbank database, the antigenic epitope encoded by it was analyzed, and an epitope containing 125 amino acids was screened out. Design specific primers, introduce HindⅢ and EcoRI restriction sites at both ends of the sequence, and introduce protective base GC at both ends of the restriction sites.

[0077] Primers for CWP-2:

[0078] Gl-CWP2-F5:CC AAGCTT AGGCAGACAGTAGTCCGC(HindIII)

[0079] Gl-CWP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a bivalent DNA vaccine for preventing human or animal giardiasis, wherein two antigen genes α1-giardin and CWP-2 of Giardia are respectively inserted into eukaryotic vector pVAX1 to obtain recombinant plasmid pVAX1 -α1-giardin and pVAX1-CWP-2, the recombinant plasmids pVAX1-α1-giardin and pVAX1-CWP-2 are respectively transported into the host bacteria to obtain recombinant plasmid pVAX1-α1-giardin and recombinant plasmid pVAX1-CWP-respectively 2, the recombinant bacteria constitute the bivalent DNA vaccine of the present invention. The present invention creatively proposes an anti-giardiasis bivalent DNA vaccine for the joint application of trophozoites and cysts, which can inhibit the formation of trophozoites to block pathogenicity and inhibit the formation of cysts to cut off transmission. It overcomes the shortcomings of the single role of the vaccine in the previous vaccine research and development. The bivalent DNA vaccine of the present invention also achieves stable passage and continuous protection. The invention also discloses an enteric-coated preparation quantitatively containing the bivalent DNA vaccine and a preparation method thereof.

Description

technical field [0001] The invention relates to the field of vaccines, in particular to a bivalent DNA vaccine for preventing human and animal giardiasis and an enteric-coated preparation thereof. Background technique [0002] Giardia lamblia (Giardia lamblia for short) is a human pathogenic protozoa that can cause diarrhea, malabsorption syndrome and growth disorders in children. There are about 500,000 new infections every year in the world, and the infection rate among AIDS patients is extremely high (about 20%-50%). It has been listed by the World Health Organization as one of the ten major parasitic diseases that endanger human health in the world. . In addition, Giardia can infect more than 40 kinds of animals, which is a typical zoonotic disease and one of the important parasites that endanger the development of animal husbandry in my country. [0003] The life cycle of Giardia includes two developmental stages, trophozoite and cyst, and two processes of exocyst and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/002A61K48/00A61K9/36C12N15/70C12N15/63A61P33/02
CPCY02A50/30
Inventor冯宪敏郑文彧李瑶崔柏吉张宏梅
OwnerJINLIN MEDICAL COLLEGE