CHO cell strain stably expressing anti-AGR2 humanized monoclonal antibody and application thereof
A monoclonal antibody, stable expression technology, applied in the direction of antibodies, anti-tumor drugs, anti-enzyme immunoglobulins, etc., to achieve the effect of inhibiting growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Stability detection of anti-AGR2 humanized monoclonal antibody expressed in CHO cell line K70E10-1D6
[0044] 1 Experimental method
[0045] (1) Serial passage of cell lines
[0046] The CHO cell line K70E10-1D6 with the deposit number of CCTCC NO: C2014189 was 3×10 5 cells / ml were inoculated into a 4ml system in a 6-well cell culture plate, and the medium was CD CHO Serum-Free Medium for CHO Cells (Sigma-Aldrich), added glutamine with a final concentration of 8 mM, and added 40 μl of Anti-clumping Agent. Since this cell line contains a puromycin resistance tag, it needs to be done in parallel, one of which is added with a final concentration of 10 μg / ml of puromycin. Placed at 37°C, relative humidity 70-80%, 5% carbon dioxide cell incubator for culture on a shaker at a rotational speed of 125±5rpm.
[0047] After culturing for 2 days, the cell growth was observed and counted. When counting, first take 50 μL, add 50 μL of 0.4% trypan blue staining solution, and th...
Embodiment 2
[0075] Detection of green fluorescent label in CHO cell line K70E10-1D6
[0076] 1 Experimental method
[0077] (1) Fluorescence microscope observation
[0078] CHO cell line K70E10-1D6 was in the logarithmic growth phase (usually 2-3 days after inoculation), the cell suspension was taken out and added to a 10mm cell culture dish, and the green fluorescence was observed with an inverted fluorescence microscope. The green fluorescence can be observed at a magnification of 40 times, and a photo of the green fluorescence can be taken at a magnification of 100 times, and a white light photo of the same position is taken as a control at the same time.
[0079] (2) Detection by flow cytometry
[0080] The CHO cell line K70E10-1D6 and CHO-S cells were distributed according to 3 × 10 5 The density of each / ml was respectively inoculated into 10mm dishes, the medium system was 10ml, glutamine with a final concentration of 8mM was added, and 40μL of Anti-clumping Agent was added. Aft...
Embodiment 3
[0088] Removal of green fluorescence in CHO cell line K70E10-1D6 cell line by transfection of DNA fragment cre plasmid-free
[0089] 1 Experimental method
[0090] (1) Preparation of DNA fragment cre plasmid-free
[0091] The template for DNA fragment cre plasmid-free preparation by PCR method is: pBS185 plasmid, using the following primers:
[0092] Sense: GCCAAGCTTGGCCCATTGCATACG (SEQ No. 3)
[0093] Anti-sense: GAGGAAGCTTATGGGATATAGCTTG (SEQ No. 4)
[0094] After pre-denaturation at 94°C for 2 min, the cycle was started. The cycle conditions of the PCR reaction were as follows:
[0095]
[0096] After PCR amplification, take 5 μl of each product and perform 1% agarose gel electrophoresis to determine the size of the DNA fragment cre plasmid-free. If the DNA fragment is present and successfully amplified, a bright light should be seen at the 3300bp position. Bands.
[0097] All PCR products were subjected to 1% agarose gel electrophoresis. According to the operating ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More