Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus

A technology for stable expression of human cytomegalovirus, applied in human cytomegalovirus pp65 gene and its application field, can solve problems such as not being used as a control, preparation of positive controls, differences, etc., and achieve the effect of adapting to large-scale production

Inactive Publication Date: 2015-05-20
BIOHIT BIOTECH HEFEI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004]However, the HCMV pp65 antigenemia detection kit used as a clinical diagnosis needs accurate and reliable positive control. It is difficult for HCMV to infect mononuclear cells in vitro, so in vitro infection cannot be used. Positive controls were prepared by staining cells with monocytes; in most patients, the number of cells positive for HCMV pp65 antigenemia is small (less than 1%), so it is difficult to directly use monocytes from known positive patients as positive controls ; If the pp65 gene is directly transfected into cells, the pp65 protein will be expressed in the cytoplasm, which is significantly different from the expression of pp65 in the nucleus during HCMV infection, so it cannot be used as a control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A preparation method for stably expressing human cytomegalovirus pp65 protein K562 cell line in the nucleus is characterized in that:

[0032] The preparation method comprises the following steps:

[0033] (1) Preparation of pp65 gene with nuclear localization signal connected to the 3' end

[0034] According to the gene sequence of HCMV AD169 strain published in Genebank, the coding sequence of HCMV pp 65 gene was determined, and the PCR primers for amplifying HCMV pp 65 were designed. Using HCMV AD169 DNA as template, three rounds of nested PCR were used to obtain the 3' end carrying The pp65 gene of the nuclear localization signal was connected to the PLVX-Puro plasmid, the recombinant plasmid PLVX-Puro-pp65-NLS was constructed, transformed into Escherichia coli DH5α, the plasmid was extracted, and the recombinant vector with the correct sequence was obtained by DNA sequencing;

[0035] (2) Lentiviral packaging

[0036] Mix the recombinant vector PLVX-Puro-pp65-NL...

Embodiment 2

[0042] (1) Construction of pp65 gene with nuclear localization signal at the 3' end

[0043] 1) Design nested PCR primers according to the gene sequence of HCMVAD169 strain published in Genebank

[0044] F: 5'-CTCGAGATGGAGTCGCGCGGT-3';

[0045] R1: 5'-TGGATCTACCTTTCTCTTTCTTTTTTGGATCACCTCGGTGCTTTTTG-3';

[0046] R2: 5'-TGGATCTACCTTTCTCTTTCTTTTTTGGATCTGGATCTACCTTTC-3';

[0047] R3: 5'-GGTACC TCTAGATCCGGTGGATCCTACCTTTTCTT TGGATCTACCTTTCTC-3'

[0048] 2) Extract DNA from HCMV AD169 strain-infected MRC-5 cells using the phenol: chloroform: isoamyl alcohol method as a PCR template;

[0049] 3) Using HCMV AD169 strain virus DNA as a template, carry out PCR amplification with primers F and R1;

[0050] 4) Take 2 μl of the PCR product as a template, and perform PCR amplification with primers F and R2;

[0051] 5) Take 2 μl of the PCR product as a template, and perform PCR amplification with primers F and R3;

[0052] 6) The nuclear localization signal DPKKKRKVDPDPKKKKRKVDPKRKVGST...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new establishment method and application of a cell strain for stably human cytomegalovirus (HCMV) pp65 protein in nucleus. A nucleus localization signal (pp65-NLS) is added to the 3' end of the HCMV pp65 gene, so that the endonuclear expressed pp65 gene transfected by the gene has the same cellular localization as the host-cell-infected HCMV; and the pp65-NLS is integrated into the K562 cell under the mediation of slow virus, thereby establishing the K562 cell strain for stably expressing 9965-NLS. The cell strain can be used as a positive reference substance of an HCMV 9965 antigenemia detection kit, thereby implementing the reliable application of the kit in clinical diagnosis.

Description

technical field [0001] The present invention relates to a recombinant gene expression system, specifically, the present invention relates to stably expressing human cytomegalovirus pp65 gene with nuclear localization signal after artificial transformation in cells and its application. Background technique [0002] Human cytomegalovirus (HCMV) infection is very common in the population, and it is distributed worldwide. About 90% of adults in China can detect HCMV antibodies. It is known that the first infection of human HCMV (also known as primary infection) usually occurs within 2 years of age, and once infected, the virus is difficult to be cleared from the body, and most of them remain latent in the host body for life. In people with normal immune function, the virus and the host are in a "balanced" state. When the body's immunity is low due to various reasons (HIV infection, transplantation, aging, etc.), this "balance" will be broken and cause HCMV to regenerate. To act...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/38C12N5/10G01N33/569
Inventor王明丽甘霖刘峰
OwnerBIOHIT BIOTECH HEFEI