Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof
A technology of Bacillus subtilis and pullulanase, which is applied in the field of constructing recombinant strains of Bacillus subtilis, can solve the problems of poor acid resistance, low yield and low heat stability of pullulanase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: Construction of recombinant plasmid pGE-BPB
[0030] The gene operon BPB that is used for the expression of pullulanase comprises a gene sequence and terminator of the coding BnPulB (its nucleotide sequence shown in SEQ ID NO.3) by tandem promoter Pga2 and codon optimization Sequence T-aprE, wherein Pga2 is composed of promoter PyxiE and RNA stabilization factor CryIIIA (the nucleotide sequence of Pga2 is shown in SEQ ID NO.2), and the sequence immediately after the start codon ATG is SPamyL, the relevant The nucleotide sequence was generated by Jinweizhi Biotechnology Company using DNA chemical synthesis method to generate gene fragments, and the gene operon BPB was constructed to obtain the gene operon BPB, and then the gene operon BPB was cloned into the plasmid pUC57 to generate pUC57-BPB. BPB with Eco RI sites at both ends was obtained by PCR obtained by the following method:
[0031]Upstream primer: CAAGGAATTCCATGGCCGGCCGACCGGG
[0032] Downstream ...
Embodiment 2
[0050] Embodiment 2: the molecular biological operation of the recombinant Bacillus subtilis producing pullulanase
[0051] 1. Transfer pGE-BPB into Bacillus subtilis 168 competent cells.
[0052] First prepare the chemically competent cells of Bacillus subtilis, which is prepared by two culture methods: activate Bacillus subtilis 168 on LB agar plate, take a single clone to culture in LB, transfer to SP I at a volume ratio of 5% culture medium at 30°C until the logarithmic growth phase, then transferred to the SP II medium at the same volume ratio and cultured to the logarithmic growth phase, centrifuged to collect the cells, and then resuspended the cell pellet into the SP II medium to form Concentrated competent cells with an OD600 of approximately 5.0. The formula of SPI medium in the present embodiment is: 0.02% casein acid hydrolyzate, 0.1% yeast powder, 0.5% glucose, 0.2% (NH 4 ) 2 SO 4 , 1.4% K 2 HPO 4 ·3H 2 O, 0.6% KH 2 PO 4 , 0.1% sodium citrate and 0.02% Mg...
Embodiment 3
[0078] Embodiment 3: fermentative production of pullulanase by recombinant Bacillus subtilis strain CH-1
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap