Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof

A technology of Bacillus subtilis and pullulanase, which is applied in the field of constructing recombinant strains of Bacillus subtilis, can solve the problems of poor acid resistance, low yield and low heat stability of pullulanase

Active Publication Date: 2015-06-10
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at solving the technical problems of low thermal stability, low acid resistance and low yield of pullulanase produced by microorganisms in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof
  • Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: Construction of recombinant plasmid pGE-BPB

[0030] The gene operon BPB that is used for the expression of pullulanase comprises a gene sequence and terminator of the coding BnPulB (its nucleotide sequence shown in SEQ ID NO.3) by tandem promoter Pga2 and codon optimization Sequence T-aprE, wherein Pga2 is composed of promoter PyxiE and RNA stabilization factor CryIIIA (the nucleotide sequence of Pga2 is shown in SEQ ID NO.2), and the sequence immediately after the start codon ATG is SPamyL, the relevant The nucleotide sequence was generated by Jinweizhi Biotechnology Company using DNA chemical synthesis method to generate gene fragments, and the gene operon BPB was constructed to obtain the gene operon BPB, and then the gene operon BPB was cloned into the plasmid pUC57 to generate pUC57-BPB. BPB with Eco RI sites at both ends was obtained by PCR obtained by the following method:

[0031]Upstream primer: CAAGGAATTCCATGGCCGGCCGACCGGG

[0032] Downstream ...

Embodiment 2

[0050] Embodiment 2: the molecular biological operation of the recombinant Bacillus subtilis producing pullulanase

[0051] 1. Transfer pGE-BPB into Bacillus subtilis 168 competent cells.

[0052] First prepare the chemically competent cells of Bacillus subtilis, which is prepared by two culture methods: activate Bacillus subtilis 168 on LB agar plate, take a single clone to culture in LB, transfer to SP I at a volume ratio of 5% culture medium at 30°C until the logarithmic growth phase, then transferred to the SP II medium at the same volume ratio and cultured to the logarithmic growth phase, centrifuged to collect the cells, and then resuspended the cell pellet into the SP II medium to form Concentrated competent cells with an OD600 of approximately 5.0. The formula of SPI medium in the present embodiment is: 0.02% casein acid hydrolyzate, 0.1% yeast powder, 0.5% glucose, 0.2% (NH 4 ) 2 SO 4 , 1.4% K 2 HPO 4 ·3H 2 O, 0.6% KH 2 PO 4 , 0.1% sodium citrate and 0.02% Mg...

Embodiment 3

[0078] Embodiment 3: fermentative production of pullulanase by recombinant Bacillus subtilis strain CH-1

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacillus subtilis of high-yield pullulanase and a construction method thereof. The construction method of the recombinant bacillus subtilis of the high-yield comprises the following steps that an artificial operon BPB used for expressing the pullulanase is used for constructing a recombinant plasmid pGE-BPB; the nucleotide sequence of the artificial operon BPB is shown in the graph SEQ ID NO.4; the constructed recombinant plasmid pGE-BPB is converted into a bacillus subtilis competent cell, and through secondary recombination, a neutral protease gene nprE in the bacillus subtilis competent cell is replaced by the artificial operon BPB in situ. According to the recombinant bacillus subtilis of the high-yield pullulanase and the construction method thereof, firstly, the acidproof and heatproof pullulanase gene of an original bacterial strain is optimized, based on the synthetic biology method, a plurality of molecular elements capable of improving the gene transcriptional level are assembled into the artificial operon, and the recombinant bacillus subtilis can be obtained through construction. The recombinant bacterial strain can ferment to generate the high-yield pullulanase, and the enzyme activity each unit can reach or exceed 300 U / ml.

Description

technical field [0001] The invention belongs to the technical field of construction of recombinant strains of Bacillus subtilis, and in particular relates to a recombinant Bacillus subtilis with high pullulanase production and a construction method thereof. Background technique [0002] Pullulanase is a kind of starch debranching enzyme secreted and expressed by microorganisms. Type I pullulanase can specifically cut the α-1,6 glycosidic bond in the amylopectin branch to form amylose. Pullulan The enzyme acts synergistically with other amylases, and has important uses and good market prospects in the starch processing industry. Therefore, countries in the world have invested a large amount of manpower and financial resources to develop the production strain of pullulanase. So far, it has been found that many microorganisms can produce pullulanase, but due to the limitations of current industrial production conditions (acid resistance, high temperature resistance conditions),...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/56C12N9/44C12N15/75C12R1/125
CPCC12N9/2457C12Y302/01041
Inventor孙俊松史吉平陈超姜标
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI