Dna vaccine against pseudotuberculosis in marine fish
A DNA vaccine, fish technology, applied in the field of DNA vaccine, can solve the problem of no DNA vaccine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] "Example 1: from P. damselae subsp. Piscicida Isolation of the ppa1 gene, ppa2 gene and ppars1 gene of
[0072] (1) Preparation of PCR primers
[0073] According to the usual method, from the P. damselae subsp. Piscicida The following PCR primers were prepared according to the nucleotide sequences of DNA corresponding to the ppa1 gene (SEQ ID NO: 1), ppa2 gene (SEQ ID NO: 3) and ppars1 gene (SEQ ID NO: 5).
[0074] ppa1-Forward = 5'CGGAATTCACCATGAATCGTAAAGTAACTA 3' (SEQ ID NO: 13);
[0075] ppa1-reverse = 5'CCGCTCGAGCTTAGTGTAAGAACCAC 3' (SEQ ID NO: 14);
[0076] ppa2-Forward = 5'CGGAATTCACCATGAGAAAACCTCTGCTTG 3' (SEQ ID NO: 15);
[0077] ppa2-reverse = 5'CCGCTCGAGACGCATGATTAAATACA 3' (SEQ ID NO: 16);
[0078] ppars1-reverse = 5'CGGAATTCACCATGTCTAAAGTTCGTTATG 3' (SEQ ID NO: 17);
[0079] ppars1-reverse = 5' CCGCTCGAGTTCAGCAAGAACTTGAG 3' (SEQ ID NO: 18).
[0080] (2) Preparation of DNA vaccine
[0081] Will P. damselae subsp. Piscicida The TUMSAT-PPE05-02 str...
Embodiment 2
[0085]"Example 2: Production of ppa1 gene, ppa2 gene and ppars1 gene modified according to the codon usage frequency of flounder"
[0086] (1) Production of artificial genes using modified sequences
[0087] There are multiple codons for specifying amino acids in any biological species, and their frequency of use is different. Therefore, artificial synthesis based on P. damselae subsp. Piscicida The ppa1 gene (SEQ ID NO: 7), the ppa2 gene (SEQ ID NO: 9) and the ppars1 gene (SEQ ID NO: 11) whose nucleotide sequences were modified with the codon usage frequency of flounder were inserted into the plasmid.
Embodiment 3
[0088] "Example 3: Production of plasmids wild-ppa1, wild-ppa2, wild-ppars1, opt-ppa1, opt-ppa2 and opt-ppars1"
[0089] The plasmids used in the DNA nucleotide sequence analysis of Example 1(3) and Example 2(1) were treated with EcoRI and XhoI. Then, cut out from each vector from P. damselae subsp. Piscicida TUMSAT-PPE05-02 strain or polyclonal ppa1 gene, ppa2 gene and ppars1 gene of artificial gene inserted downstream of the sequence encoding the promoter region derived from human cytomegalovirus in pcDNA3.1 / myc-his vector (manufactured by Invitrogen Corporation) The EcoRI and XhoI recognition sites of the sites were used to produce plasmids wild-ppa1, wild-ppa2, wild-ppars1, opt-ppa1, opt-ppa2, and opt-ppars1.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com