Dna vaccine against pseudotuberculosis in marine fish

A DNA vaccine, fish technology, applied in the field of DNA vaccine, can solve the problem of no DNA vaccine

Active Publication Date: 2015-06-24
TOKYO UNIV OF MANNE SCI & TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But no DNA vaccines have been reported in other fish species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dna vaccine against pseudotuberculosis in marine fish
  • Dna vaccine against pseudotuberculosis in marine fish
  • Dna vaccine against pseudotuberculosis in marine fish

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] "Example 1: from P. damselae subsp. Piscicida Isolation of the ppa1 gene, ppa2 gene and ppars1 gene of

[0072] (1) Preparation of PCR primers

[0073] According to the usual method, from the P. damselae subsp. Piscicida The following PCR primers were prepared according to the nucleotide sequences of DNA corresponding to the ppa1 gene (SEQ ID NO: 1), ppa2 gene (SEQ ID NO: 3) and ppars1 gene (SEQ ID NO: 5).

[0074] ppa1-Forward = 5'CGGAATTCACCATGAATCGTAAAGTAACTA 3' (SEQ ID NO: 13);

[0075] ppa1-reverse = 5'CCGCTCGAGCTTAGTGTAAGAACCAC 3' (SEQ ID NO: 14);

[0076] ppa2-Forward = 5'CGGAATTCACCATGAGAAAACCTCTGCTTG 3' (SEQ ID NO: 15);

[0077] ppa2-reverse = 5'CCGCTCGAGACGCATGATTAAATACA 3' (SEQ ID NO: 16);

[0078] ppars1-reverse = 5'CGGAATTCACCATGTCTAAAGTTCGTTATG 3' (SEQ ID NO: 17);

[0079] ppars1-reverse = 5' CCGCTCGAGTTCAGCAAGAACTTGAG 3' (SEQ ID NO: 18).

[0080] (2) Preparation of DNA vaccine

[0081] Will P. damselae subsp. Piscicida The TUMSAT-PPE05-02 str...

Embodiment 2

[0085]"Example 2: Production of ppa1 gene, ppa2 gene and ppars1 gene modified according to the codon usage frequency of flounder"

[0086] (1) Production of artificial genes using modified sequences

[0087] There are multiple codons for specifying amino acids in any biological species, and their frequency of use is different. Therefore, artificial synthesis based on P. damselae subsp. Piscicida The ppa1 gene (SEQ ID NO: 7), the ppa2 gene (SEQ ID NO: 9) and the ppars1 gene (SEQ ID NO: 11) whose nucleotide sequences were modified with the codon usage frequency of flounder were inserted into the plasmid.

Embodiment 3

[0088] "Example 3: Production of plasmids wild-ppa1, wild-ppa2, wild-ppars1, opt-ppa1, opt-ppa2 and opt-ppars1"

[0089] The plasmids used in the DNA nucleotide sequence analysis of Example 1(3) and Example 2(1) were treated with EcoRI and XhoI. Then, cut out from each vector from P. damselae subsp. Piscicida TUMSAT-PPE05-02 strain or polyclonal ppa1 gene, ppa2 gene and ppars1 gene of artificial gene inserted downstream of the sequence encoding the promoter region derived from human cytomegalovirus in pcDNA3.1 / myc-his vector (manufactured by Invitrogen Corporation) The EcoRI and XhoI recognition sites of the sites were used to produce plasmids wild-ppa1, wild-ppa2, wild-ppars1, opt-ppa1, opt-ppa2, and opt-ppars1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Provided is a DNA vaccine for use in fish which induces protective immunity against pseudotuberculosis. As the active component, this DNA vaccine contains DNA containing a nucleotide sequence that encodes a polypeptide that is immunogenic against Photobacterium damselae subsp. piscicida, or contains an expression vector containing said DNA.

Description

technical field [0001] The invention relates to a method for inducing the pathogenic bacterium Photobacterium mermaidus piscicidal subspecies ( Photobacterium damselae subsp. piscicida ) DNA vaccine for protective immunity. [0002] "Pseudotuberculosis (pseudotuberculosis)" in this description refers to P. damselae subsp. piscicida sarcoidosis caused by the infection of the genus, therefore, includes not only the sarcoidosis that occurs in the green squid (Seriola quinqueradiata, amberjack), but also includes fishes other than the squid [such as those belonging to the order Perciformes (Perciformes) fish (black bream, red sea bream, red-spotted grouper, etc.), fish belonging to the order Osmeriformes (sweetfish, etc.), fish species belonging to the order Tetraodontiformes (green fin Pasteurellosis (Pasteurellosis) caused by the same pathogen in horse-faced fish, etc.). Background technique [0003] In the aquaculture industry of many aquatic organisms represented by seaf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/00A61K39/02A61P31/04C12N15/09
CPCA61K39/102A61K2039/53A61K2039/552A61P31/04A61P33/00
Inventor 广野育生近藤秀裕山下梢
Owner TOKYO UNIV OF MANNE SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap