Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Knickkopf gene dsRNA in pest control

A technology of genes and gene fragments, which is applied in the application field of migratory locust knockkopf gene dsRNA in pest control, can solve the problems of insect molting retardation, epidermal chitin arrangement disorder, etc., and achieve the effect of high lethality

Inactive Publication Date: 2015-07-15
SHANXI UNIV
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Knk gene is involved in the orderly arrangement of chitin in the cuticle of insects, and the silencing of the gene will lead to disordered arrangement of chitin in the cuticle, loss of the normal function of the cuticle, and death of insects due to molt retardation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Knickkopf gene dsRNA in pest control
  • Application of Knickkopf gene dsRNA in pest control
  • Application of Knickkopf gene dsRNA in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Example 1: Acquisition of full-length cDNA of migratory locust Knk gene and prediction of amino acids

[0016] 1. Search for Knk gene fragments in migratory locusts

[0017] Unigene search was carried out from the transcriptome database of migratory locusts, and then analyzed by NCBI Blastx online software, and a Knk gene fragment of migratory locusts was determined to be obtained.

[0018] 2. Acquisition of full-length cDNA of migratory locust Knk gene

[0019] 1) Design of primers required for PCR amplification:

[0020] The GeneDoc software was used to splice and compare the Knk gene fragments obtained from the search, and the primer premier5.0 software was used to design the upstream primer AAGAAATGCACGAATTAGCAATATG (SEQ ID NO: 3) and the downstream primer TTAACACTAATTTTGCATCACAGTCC (SEQ ID NO: 4). The designed primers were sent to Shanghai Yingwei Jieji Biological Co., Ltd. for synthesis.

[0021] 2) Template preparation required for PCR amplification:

[0022]...

Embodiment 2

[0027] Embodiment 2: the dsRNA synthesized by migratory locust Knk gene fragment

[0028] 1. Primers required for dsRNA synthesis of migratory locust Knk gene fragment

[0029] Based on the nucleotide sequence SEQ ID NO: 1 of the migratory locust Knk gene obtained by sequencing, a pair of primers required for synthesizing dsRNA was designed using primer premier5.0 software. The sequences taatacgactcactatagggAACATCACGGCTCAGTCT CC (SEQ ID NO: 5) and taatacgactcactatagggGGGAACCAAGTAGCCATTGA (SEQ ID NO: 6) are the upstream and downstream primers, respectively. (The part in italics is the T7 promoter). The designed primers were sent to Shanghai Yingwei Jieji Biological Co., Ltd. for synthesis.

[0030] 2. Template preparation for dsRNA synthesis of migratory locust Knk gene fragment

[0031] The designed and synthesized primers (all containing the T7 promoter sequence) for the synthesis of dsRNA were subjected to PCR amplification to obtain a fragment with a length of 538 bp. I...

Embodiment 3

[0034] Embodiment 3: The lethal experiment of migratory locust Knk gene fragment synthetic dsRNA to migratory locust

[0035] 1. Injection of dsRNA synthesized by migratory locust Knk gene fragment

[0036] Pick 25 5th-instar 2-day-old nymphs with good growth, uniform size, and half male and half male for dsRNA injection. The worms injected with dsGFP were set as the control group, and the dsRNA (dsKnk) synthesized by the knk gene fragment was set as the experimental group. Gently inject 2.5 μl (6.25 μg) of dsKnk into the body cavity of the migratory locust along the contraction direction of the abdomen of the migratory locust using a micro-injector. Simultaneously pick the same number of healthy nymphs and inject the same amount of dsGFP. After the injection, the two groups of nymphs were placed under the same conditions (light:dark time=14h:10h, temperature 30±2°C, humidity 60%). Feed sufficient fresh wheatgrass and wheat bran.

[0037] 2. Detection of mRNA expression of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of Knickkopf gene dsRNA in pest control, and in particularly relates to a migratory locust Knickkopf gene. A nucleotide sequence of the migratory locust Knickkopf gene is SEQ ID NO: 1; and based on SEQ ID NO: 1, gene segments and corresponding dsRNA are designed and synthesized. After the designed and synthesized dsRNA is injected into bodies of migratory locust, difficult molting of migratory locust can be caused to result in death of migratory locust; and the death rate can reach 76%. The Knickkopf gene obtained by screening, provided by the invention, can be taken as a molecular target for pest control, and can be used for providing a new path for effective control of pests.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of migratory locust knockkopf (Knk) gene dsRNA in pest control. Background technique [0002] At present, the control of agricultural pests mainly relies on the application of chemical pesticides. The long-term application of pesticides has caused a series of problems. The resistance of pests to pesticides has increased, resulting in an increase in the dosage of pesticides. A large number of pesticide residues will increase the pollution of the environment and eventually endanger human health. Therefore, there is an urgent need to develop environmentally friendly biopesticides. [0003] RNA interference (RNAi) refers to the specific binding of double-stranded RNA (double-stranded RNA, dsRNA) to homologous mRNA to degrade it, resulting in gene silencing and preventing the normal expression of genes. RNAi technology was reported in Caenorhabditis elegans in 1998 and w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/10C07K14/435A01N63/02A01P7/04
Inventor 张建珍于荣荣李涛丁国伟马恩波
Owner SHANXI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More