Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of hydroxylase gene Dr2473 to catalytic synthesis of microorganisms

A biosynthetic and microbial technology, applied in the field of microorganisms, can solve the problem that the key hydroxylase gene at the C-2 position of the Beta ring has not been reported.

Active Publication Date: 2015-08-26
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In Deinococcus radiodurans, a series of genes encoding functional enzymes involved in the carotene synthesis process have been discovered and identified, but the key hydroxylase gene at the C-2 position of the Beta ring has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of hydroxylase gene Dr2473 to catalytic synthesis of microorganisms
  • Application of hydroxylase gene Dr2473 to catalytic synthesis of microorganisms
  • Application of hydroxylase gene Dr2473 to catalytic synthesis of microorganisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Expression of Deinococcus radiodurans Dr2473 gene sequence in Escherichia coli

[0029] 1. Experimental method

[0030] 1. Design a pair of PCR-specific primers based on the published Dr2473 gene sequence in the Deinococcus radioduran genome:

[0031] 0395-F: 5′ ACCACTAGT ATGCTTTCCTCTCTGCACGATTTGCCC 3′

[0032] 0395-R: 5′ACCCATATG CTAGCGCCGCTCCACGACCA 3′

[0033] 2. Amplify the target gene sequence from the genomic DNA of Deinococcus radiodurans by PCR method.

[0034] Reaction conditions: 94°C for 10min, [94°C for 30sec, 60°C for 30sec, 72°C for 1.5min] 35 cycles, 72°C for 10min.

[0035] 3. After the PCR product was recovered by gel, it was cloned on the vector pJET, named pJET-2473, and verified by sequencing; then the Dr2473 gene containing cohesive ends and the pRADZ3 vector containing the groEL promoter were obtained by SpeI / NdeI double digestion. The Dr2473 gene was connected to the pRADZ3 vector to construct the Escherichia coli expression vector p...

Embodiment 2

[0039] Example 2 Catalytic Activity Experiment of Recombinant Engineering Bacteria Containing Deinococcus radioduran Strain Dr2473

[0040] 1. Experimental materials

[0041] Recombinant engineering strain: the JM-2473 strain containing the Dr2473 gene obtained in Example 1

[0042] Control strain: the JM-Z3 strain containing the empty plasmid described in Example 1.

[0043] 2. Experimental method

[0044] 1. Streak activation of the control strain and the recombinant engineering strain on the LB solid medium plate;

[0045] 2. Pick a single colony and inoculate it in liquid LB medium supplemented with corresponding antibiotics, and cultivate it at 37°C until the middle and late stages of the index;

[0046] 3. Add carotenoid substrate compounds to the culture medium, and continue culturing at 37° C. for 24 hours.

[0047] 4. Centrifuge for 10 minutes; discard the supernatant and collect the bacteria. Avoid light as much as possible during operation.

[0048] 5. Add 3 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discovers a gene with a hydroxylase function discovered from deinococcus radiodurans. The invention constructs a recombinant vector containing the gene, and the recombinant vector is expressed in prokaryotic host cell Escherichia coli. An experiment proves that after the gene is expressed in the prokaryotic host cell, carotenoid can be catalyzed to perform hydroxylation reaction. The gene can be used in the catalytic synthesis of the microorganisms.

Description

technical field [0001] The invention belongs to the technical field of microbes, and relates to a novel gene that functions as a hydroxylase in the synthesis process of carotenoid secondary metabolites. Background technique [0002] Secondary metabolites are small molecular organic compounds that are not necessary for the growth and development of cell life activities, which are produced by secondary metabolism and whose precursors are primary metabolites. Microbial secondary metabolites are widely used in medicine and agricultural production due to their diversity in structure and activity. [0003] Carotenoids are a class of secondary metabolites that are mainly synthesized by plants or microorganisms. They have antioxidant activity and perform functions in organisms such as quenching singlet oxygen, scavenging free radicals, and preventing lipid peroxidation. Carotenoids are used as active ingredients in food pigments, feed additives and pharmaceutical cosmetics because ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/02C12P23/00
Inventor 张维周正富徐玉泉柯秀彬陈明
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com