Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant oncolytic II-type herpes simplex virus (HSV) and pharmaceutical composition thereof

A herpes simplex virus and oncolytic technology, applied in the field of recombinant herpes simplex virus, can solve the problems of tumor-associated antigen capture and presentation, and achieve the effect of enhancing immunogenicity

Inactive Publication Date: 2015-09-02
刘滨磊
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although GM-CSF expressed by oHSV2-GM-CSF can promote the maturation of DC, the tumor-associated antigen (such as telomerase antigen) released by viral oncolysis may not be effectively captured and presented by DC cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant oncolytic II-type herpes simplex virus (HSV) and pharmaceutical composition thereof
  • Recombinant oncolytic II-type herpes simplex virus (HSV) and pharmaceutical composition thereof
  • Recombinant oncolytic II-type herpes simplex virus (HSV) and pharmaceutical composition thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] A method for preparing recombinant oncolytic herpes simplex virus type II, comprising the following steps:

[0078] (1) Delete the ICP47 gene from the wild type II herpes simplex virus HG52 strain to construct HG52dICP47 recombinant type II herpes simplex virus:

[0079] a. Genomic DNA of type II herpes simplex virus HG52 strain is extracted;

[0080] b. Construct the plasmid pdICP47H2 containing the upstream flanking region sequence and the downstream flanking region sequence of the ICP47 gene:

[0081] b1. Use the following primers for amplifying the sequence of the upstream flanking region of the ICP47 gene and the sequence of the downstream flanking region of the ICP47 gene, and use the genomic DNA obtained in step a as a template to amplify the sequence of the upstream flanking region and the downstream flanking region of the ICP47 gene by PCR sequence;

[0082] Amplify ICP47 gene forward primer 146554 AGAGTCACGACGCATTTGCCC 146574

[0083] Upstream flanking se...

Embodiment 2

[0127] Example 1 is used to prepare virus preparation medicine:

[0128] 1. Establishment of two tumor animal models and the in vivo oncolytic effect of the recombinant virus vector of the present invention

[0129] 1) Purchase C57 / BL and Balb / c female mice from the Experimental Animal Center of the Chinese Academy of Medical Sciences, 4-6 weeks old (C57 / BL is a tumor-bearing strain of melanoma B16R, and BALB / c is a tumor-bearing strain of CT26) , 16-20 grams;

[0130] 2) Node melanoma (B16R) and intestinal cancer (CT26) cells were selected respectively, and inoculated subcutaneously into the right axilla of the mouse with a trocar. Inject 10 subcutaneously in the flank of each mouse 5 Tumor cells, when the diameter of the tumor mass was about 0.5-0.7 cm (5-7 days after injection), randomly divided into 3 groups with 10 animals in each group (the experimental group was oHSV2-CADV, and the control group was pSLC-Te-Fc DNA vaccine, blank control group),

[0131]3) Then use t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant oncolytic II-type herpes simplex virus (HSV) and a pharmaceutical composition thereof. Two ICP34.5 genes and one ICP47 gene are knocked out of a genome of the recombinant oncolytic II-type HSV, human telomerase chemotactic gene SLC-Te-Fc expression boxes are respectively inserted into sites of the two ICP34.5 genes, and the human telomerase chemotactic gene SLC-Te-Fc expression boxes are orderly connected to a CMV promoter, a secondary lymphoid tissue chemotactic factor SLC, a telomerase Te (named as TERT), an immune globulin Fc segment and a bovine growth hormone polyadenosine sequence BGHpA. Oncolytic HSV has strong oncolytic effects, can be used as a gene carrier, and can carry and highly express tumor-related antigens to form a therapeutic immune gene vaccine. Through combination, the problem that the single oncolytic HSV cannot greatly induce specific antineoplastic immunization is solved.

Description

technical field [0001] The invention relates to a recombinant herpes simplex virus, in particular to a recombinant oncolytic herpes simplex virus type II and a pharmaceutical composition thereof. Background technique [0002] Herpes simplex virus (HSV) is a double-stranded DNA virus with a length of about 154kb, which can replicate in the nucleus of infected host cells. The HSV vector has the following advantages: 1) wide range of host cells; 2) high virus titer; 3) large foreign gene capacity. A disadvantage of the HSV vector is its toxicity. [0003] For example, the ICP47 protein affects the function of the transport proteins (TAP1 and TAP2) associated with antigen processing and hinders the antigen presentation process of MHC I molecules. Therefore, knocking out the ICP47 gene is conducive to enhancing the immune response. In addition, deleting the ICP47 gene increases the expression of the downstream US11 gene, and US11 can resist PKR's inhibition of virus growth and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/869A61K48/00A61P35/00
Inventor 刘滨磊张叔人张文葛科立吴基良黄胜堂张友会
Owner 刘滨磊
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More