Nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in water body and detection method thereof
A kit and water body technology are applied in the field of nested PCR kits for detecting chicken manure contamination in fecal-contaminated water bodies, which can solve the problem that the method for detecting fecal contamination cannot be traced to the source, and achieve good specificity, reduce misjudgment, and high sensitivity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036]A nested PCR kit for detecting chicken manure pollution in water bodies, including two pairs of nested PCR primers, dNTP, PCR buffer, Taq enzyme, Mg 2+ and ddH 2 O, two pairs of nested PCR primers are:
[0037] SCF: 5’‐CACATGTTATCTGCACCAGC‐3’
[0038] SCR: 5’‐GTTAAGGGTACGAGTTTGTCG‐3’
[0039] NCF:5’‐CCAAATCCATCTTAGCCTCAAC‐3’
[0040] NCR: 5'-GGCGGGTTTCACATCCTT-3'.
[0041] The above two pairs of nested PCR primers were custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0042] ddH above 2 O is sterile double distilled water. The concentration of Taq enzyme is 5U / ul. Mg 2+ The concentration of the solution is 25mmol / L, which is MgCl 2 solution. The concentration of dNTPs was 2.5 mmol / L. PCR buffer is 10×PCR buffer (purchased from Takara, Code No.RR001A)
[0043] Collect fresh feces of chicken, human, pig, cow, sheep, duck, goose, and mouse, extract DNA from 0.2 grams of feces, and use it as a template for the first round of PCR amplification. Th...
Embodiment 2
[0048] Take 0.2 grams of chicken manure to extract DNA, and the measured DNA concentration is 35.0ng / ul. The DNA solution is serially diluted by the four-fold dilution method, and the dilution ratios obtained are 1 / 4 and 1 / 4 respectively. 2 , 1 / 4 3 , 1 / 4 4 , 1 / 4 5 , 1 / 4 6 , 1 / 4 7 Chicken manure DNA solution, each concentration of DNA solution was used as a template for the first round of PCR amplification, the reaction system was 2.5ul of 10×PCR buffer; 2.5ul of dNTP; 0.1ul of Taq enzyme; 2ul of 25mmol / L Mg 2+ Solution; 0.5ul concentration of 10umol / L upstream and downstream primers SCF, SCR; 2ul template DNA; sterilized ddH 2 Make up to 25ul with O; the reaction conditions are 95°C, pre-denaturation for 5min; 40 cycles of 95°C for 30s, 58°C for 30s, 72°C for 45s; 72°C for 7min, and storage at 4°C.
[0049] Perform 1% agarose gel electrophoresis on the first round of PCR products, the electrophoresis conditions are: voltage 120V, current 440mA, time 25min, the electrophor...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com