A method and application of improving the application efficiency of gene targeting technology in Aspergillus terreus
A technology of gene targeting and Aspergillus terreus, which is applied in the field of genetic engineering, can solve the problems of low homologous recombination ability of Aspergillus terreus species and restrictions on the application of screening tags
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Analysis of integration probability of exogenous DNA homologous recombination in Aspergillus terreus CICC40205 wild-type strain
[0069] 1.1 Construction of Aspergillus terreus pyruvate decarboxylase gene pdc (ATET_04633) targeting element
[0070] Primers Updc-F (5'-agagggtggtatcattccgttg-3'), Updc-R (5'-ctttacgcttgcgatcccgaacccctgagtgagaaggaacatg-3'), Dpdc-F (5'-cctgggttcgcaaagataattgatccgaaacaacctcaacccg-3') were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dpdc-R (5'- cgaggtgtgcgcaacaggcatgaatg-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Updc-F / Updc- R can amplify the upstream sequence U-pdc of the pdc gene with a size of about 1.9kb, and use primers Dpdc-F / Dpdc-R to amplify the downstream sequence D-pdc of the pdc gene with a size of 2.1kb. Using pSGF957 as a template, primer...
Embodiment 2
[0076] Example 2 Construction of NHEJ Pathway Deletion Genetic Engineering Strain At-Δku80 with ku80 Gene Knockout
[0077] 2.1 Construction of targeting elements for knocking out ku80
[0078] Primers Uku80-F (5'-gtcgtagctcttcttgccatc -3'), Uku80-R (5'-aatgggatcccgtaatcaattgccctcaatcaccatctcccttatc-3'), Dku80-F (5'- caagagcggctcatcgtcaccccattccggcctcgatgtggatg) were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dku80-R (5'-tccacgcggccatcaccgagc-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Uku80-F / Uku80- R can amplify the upstream sequence U-ku80 of ku80 with a size of about 1.5kb, and use primers Dku80-F / Dku80-R to amplify the downstream sequence D-ku80 of ku80 with a size of 1.5kb. Using the plasmid pPTR II (TAKARA, Catalog No.: 3621) as a template, using ptrA-F (5'- gggcaattgattacgggatc-3') and p...
Embodiment 3
[0083] Example 3 Construction of NHEJ Pathway Deletion Genetic Engineering Strain At-Δlig4 with Knockout of lig4 Gene
[0084] 3.1 Construction of split-marker method to knock out the targeting element of lig4
[0085] Primers Ulig4-F (5'-cggctattctcacgcagctc -3'), Ulig4-R (5'-aatgggatcccgtaatcaattgcccatacagggtcatcctcggtc-3'), Dlig4-F (5'- caagagcggctcatcgtcaccccatAtataatgatagctttgct) and C-3' were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dlig4-R (5'-cgtttgactgtcgcgacgtttcg-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Ulig4-F / Ulig4- R can amplify the upstream sequence U-lig4 of ku80 with a size of about 1.5kb, and use primers Dlig4-F / Dlig4-R to amplify the downstream sequence D-lig4 of lig4 with a size of 1.5kb, through 1.0% agarose Gel electrophoresis detection and gel tapping recovery and pur...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com