A method and application of improving the application efficiency of gene targeting technology in Aspergillus terreus

A technology of gene targeting and Aspergillus terreus, which is applied in the field of genetic engineering, can solve the problems of low homologous recombination ability of Aspergillus terreus species and restrictions on the application of screening tags

Active Publication Date: 2019-01-25
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the technical problem that the homologous recombination ability of Aspergillus terreus is low and the number of screening tags is small, the application of gene targeting technology in the field of genetic transformation of Aspergillus terreus is limited. In the method of application efficiency, the technical scheme adopted is as follows:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and application of improving the application efficiency of gene targeting technology in Aspergillus terreus
  • A method and application of improving the application efficiency of gene targeting technology in Aspergillus terreus
  • A method and application of improving the application efficiency of gene targeting technology in Aspergillus terreus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Analysis of integration probability of exogenous DNA homologous recombination in Aspergillus terreus CICC40205 wild-type strain

[0069] 1.1 Construction of Aspergillus terreus pyruvate decarboxylase gene pdc (ATET_04633) targeting element

[0070] Primers Updc-F (5'-agagggtggtatcattccgttg-3'), Updc-R (5'-ctttacgcttgcgatcccgaacccctgagtgagaaggaacatg-3'), Dpdc-F (5'-cctgggttcgcaaagataattgatccgaaacaacctcaacccg-3') were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dpdc-R (5'- cgaggtgtgcgcaacaggcatgaatg-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Updc-F / Updc- R can amplify the upstream sequence U-pdc of the pdc gene with a size of about 1.9kb, and use primers Dpdc-F / Dpdc-R to amplify the downstream sequence D-pdc of the pdc gene with a size of 2.1kb. Using pSGF957 as a template, primer...

Embodiment 2

[0076] Example 2 Construction of NHEJ Pathway Deletion Genetic Engineering Strain At-Δku80 with ku80 Gene Knockout

[0077] 2.1 Construction of targeting elements for knocking out ku80

[0078] Primers Uku80-F (5'-gtcgtagctcttcttgccatc -3'), Uku80-R (5'-aatgggatcccgtaatcaattgccctcaatcaccatctcccttatc-3'), Dku80-F (5'- caagagcggctcatcgtcaccccattccggcctcgatgtggatg) were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dku80-R (5'-tccacgcggccatcaccgagc-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Uku80-F / Uku80- R can amplify the upstream sequence U-ku80 of ku80 with a size of about 1.5kb, and use primers Dku80-F / Dku80-R to amplify the downstream sequence D-ku80 of ku80 with a size of 1.5kb. Using the plasmid pPTR II (TAKARA, Catalog No.: 3621) as a template, using ptrA-F (5'- gggcaattgattacgggatc-3') and p...

Embodiment 3

[0083] Example 3 Construction of NHEJ Pathway Deletion Genetic Engineering Strain At-Δlig4 with Knockout of lig4 Gene

[0084] 3.1 Construction of split-marker method to knock out the targeting element of lig4

[0085] Primers Ulig4-F (5'-cggctattctcacgcagctc -3'), Ulig4-R (5'-aatgggatcccgtaatcaattgcccatacagggtcatcctcggtc-3'), Dlig4-F (5'- caagagcggctcatcgtcaccccatAtataatgatagctttgct) and C-3' were designed according to the information published in the Aspergillus terreus NIH2624 genome database Dlig4-R (5'-cgtttgactgtcgcgacgtttcg-3'), using the genome of Aspergillus terreus strain CICC40205 as a template, using pfu DNA polymerase (Fermentas, Catalog No.: EP0501) for PCR amplification, using primers Ulig4-F / Ulig4- R can amplify the upstream sequence U-lig4 of ku80 with a size of about 1.5kb, and use primers Dlig4-F / Dlig4-R to amplify the downstream sequence D-lig4 of lig4 with a size of 1.5kb, through 1.0% agarose Gel electrophoresis detection and gel tapping recovery and pur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and application for improving application efficiency of a gene targeting technique in aspergillus terreus, and belongs to the technical field of gene engineering. The method comprises the following steps: firstly, by taking Aspergillus terreus as an initial bacterium, knocking off a ku80 gene or an lig4 gene so as to increase the exogenous DNA homologous recombination probability of a strain; secondly, establishing a pyrG gene deletion uracil auxotroph stain, establishing a inheritance conversion system based on a pyrG gene as a screening tag; and finally, cutting off the screening tag by using a Cre / LoxP specific binding site recombinant system, thereby obtaining a uracil auxotroph stain which can be applied to genetic modification again. By adopting the method disclosed by the invention, an efficient aspergillus terreus gene targeting platform can be established, the method has the advantages that high homologous recombination efficiency can be achieved, the bidirectional screening of the conversion system can be achieved, a screening tag cutting method is simple and feasible, the screening tag can be recycled, and the like, and basic support can be provided for efficient genetic modification of aspergillus terreus by using the gene targeting technique.

Description

technical field [0001] The invention relates to a method and application for improving the application efficiency of gene targeting technology in Aspergillus terreus, belonging to the technical field of genetic engineering. Background technique [0002] Aspergillus terreus is an important filamentous fungus that produces a variety of valuable compounds, including organic acids, enzymes, lipids, and biologically active secondary metabolites. Among them, itaconic acid and lovastatin have been industrialized and have a large market. With the continuous development of molecular biology, it is of great significance to transform the production strains through metabolic engineering and improve the production level of the target product. [0003] Gene targeting technology is an important research method in modern molecular biology. It usually refers to the homologous recombination between a DNA fragment containing a known sequence and the genome of a recipient cell, integrating int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/87C12N1/15C12R1/66
Inventor吕雪峰黄雪年李建军陈梅
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI