Double-labelling fluorescence activation type probe and method for detecting DNA by adopting same

A fluorescence-activated and labeled fluorescent technology, applied in the field of double-labeled fluorescent-activated probes, high-sensitivity analysis and detection of DNA, can solve the problems of detection sensitivity constraints, lack of signal amplification mechanism, etc., and achieve simple structure, simplified operation steps, and high sensitivity Detection effect

Inactive Publication Date: 2015-09-30
SHAANXI NORMAL UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it should be pointed out that each target DNA molecule can only react with one MB probe and only activate the fluorescence of one fluorescent molecule. The lack of a signal amplification mechanism greatly restricts the detection sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-labelling fluorescence activation type probe and method for detecting DNA by adopting same
  • Double-labelling fluorescence activation type probe and method for detecting DNA by adopting same
  • Double-labelling fluorescence activation type probe and method for detecting DNA by adopting same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] For the DNA sequence to be tested TAAATGATAGTAGAGTTATGCTAA (provided by Sangon Bioengineering (Shanghai) Co., Ltd.), design a 14-base-length RNA complementary to its base, the base sequence is AUAACUCUACUAUC, and the 3'-end is marked with a black hole quencher group (BHQ1), 5'-terminal labeling 6-carboxyfluorescein (FAM) to obtain a double-labeled fluorescence-activated probe (provided by Integrated DNA Technologies (USA)), due to the close distance, the fluorescence signal of FAM is blocked by BHQ1 quenched. Add double-labeled fluorescent-activated probes, RNase H, and DNA standard samples to be tested in 1×RNase H buffer medium, mix well, and react at 37°C, and control the initial concentration of double-labeled fluorescent-activated probes in the reaction system as 0.8μmol / L, the initial activity of RNase H is 2.5U, and the initial concentration of the DNA standard sample to be tested in the reaction system is controlled to be 0, 1, 5, 10, 20nmol / L, and the reaction ...

Embodiment 2

[0024] For the DNA sequence to be tested TAAATGATAGTAGAGTTATGCTAA (provided by Sangon Bioengineering (Shanghai) Co., Ltd.), design a DNA with a length of 14 bases complementary to its base, and wherein 3 consecutive bases are RNA bases. The base sequence is ATAAC wxya ACTATC, the 3'-end was labeled with BHQ1, and the 5'-end was labeled with FAM to obtain a double-labeled fluorescence-activated probe (provided by Integrated DNA Technologies (USA)). Due to the close distance, the fluorescence signal of FAM was quenched by BHQ1. According to the method of embodiment 1, first detect that fluorescence intensity changes with DNA standard sample concentration (C DNA ) changes in the fluorescence spectrum (see Figure 4 ), and draw a linear curve of the fluorescence intensity changing with the concentration of the DNA standard sample to be tested after 120 minutes of reaction (see Figure 5 ),Depend on Figure 4 It can be seen that as the concentration of the DNA standard sample t...

Embodiment 3

[0028] In addition to the direct detection of DNA molecules in biological samples, the double-labeled fluorescence-activated probe of the present invention can also be used for the detection of DNA products in nucleic acid amplification systems. The following uses the analysis of RCA products as an example. The principle is as follows: Image 6 As shown, the specific implementation steps are as follows:

[0029] 1. For a mutated DNA sequence TTTGTGCCTGTCCTGGGAGAGACTGGCGCACAGAGGAAGAGAATCT (provided by Integrated DNA Technologies (USA)) for exon 8 of human p53 gene, design a padlock probe GTCTCTCCCAGGACAGGCTTTTGATCACAGTTTACGGTTTAGCATAACTCTACTATCATTTACTTTACGATTTCGGCTCTTCCTCTGTGCGCCA (provided by DNAAnoTech from Integrated DNATech) Add padlock probes, ligase, and DNA standard samples to be tested in the ligase buffer medium, mix well, and react at 70°C, control the initial concentration of padlock probes in the reaction system to 20nmol / L, and the initial activity of ligase 1.0U, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a double-labelling fluorescence activation type probe and a method for detecting DNA by adopting the same. The probe is a single stranded RNA which is complementary with a basic group of to-be-detected DNA and has the length of 5-40 basic groups or is a single stranded DNA which is complementary with a basic group of to-be-detected DNA and has the length of 5-40 basic groups; 1/5-4/5 of basic groups in the DNA sequence are RNA basic groups; The two ends of the probe are labeled with a fluorophore and a quenching group. The probe is simple in structure and fluorescence is completely quenched; when the probe hybridizes with the to-be-detected DNA to form DNA/RNA heteroduplex, RNase H hydrolyzes an RNA chain in a DNA/RNA structure in a specificity manner to enable the fluorophore to be away from the quenching group and enable a fluorescence signal to be recovered; simultaneously, the dissociative probe further hybridizes with the to-be-detected DNA, is hydrolyzed by RNase H and generates the fluorescence signal; circulation is performed in such a way, so that the system fluorescence signal is remarkably amplified to realize rapid and high-sensitive detection of the to-be-detected DNA. The probe can be used for quantitative detection of DNA in an amplification product.

Description

technical field [0001] The invention belongs to the technical field of detection of biomolecules and gene markers, and in particular relates to a double-labeled fluorescence-activated probe and a method for analyzing and detecting DNA with high sensitivity using the probe under the assistance of ribonuclease H (RNase H). Background technique [0002] DNA is an important genetic material of living organisms. Accurate and sensitive detection of specific sequence DNA is of great significance for the early diagnosis of genetic diseases and pathogenic diseases, as well as the detection of pathogenic bacteria in food and environmental samples. The detection of DNA content is usually realized by DNA hybridization reaction combined with various signal labeling techniques. For example, the commonly used Southern blot hybridization method requires electrophoretic separation combined with radioactive isotope labeling or enzyme labeling, and the quantitative analysis of specific sequenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 李正平周浩贤刘成辉
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap