Marked vaccine strain of genotype ⅶ Newcastle disease virus and its application

A technology for Newcastle disease virus and vaccine strains, applied in the direction of antiviral agents, virus/phage, virus antigen components, etc., to achieve the effect of genetic stability and good immunogenicity

Active Publication Date: 2018-05-22
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the above two vaccines cannot provide strong immune protection in clinical application, which also explains why Newcastle disease is still prevalent in some areas

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marked vaccine strain of genotype ⅶ Newcastle disease virus and its application
  • Marked vaccine strain of genotype ⅶ Newcastle disease virus and its application
  • Marked vaccine strain of genotype ⅶ Newcastle disease virus and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1M

[0043] Example 1 MG7-NPΔ18 and MG7-NP mut3 strain rescue

[0044] 1. Experimental method

[0045] 1.1G7 strain genome full-length cDNA construction

[0046] Using the Trizol method to extract the genomic RNA in the allantoic fluid inoculated with chicken embryos of the G7 strain, the detailed steps are as follows:

[0047] ① Take 250 μL of chicken embryo allantoic fluid, add 750 μL Trizol (Invitrogen, USA), shake and mix well, and let stand at room temperature for 5 minutes;

[0048] ② Add 200 μL of chloroform to each tube, cap the centrifuge tube tightly, shake the centrifuge tube vigorously for 15 seconds; place at room temperature for 10 minutes, and centrifuge at 12000 rpm for 15 minutes;

[0049] ③ Take the upper aqueous phase and place it in a new centrifuge tube, add 700 μL of isopropanol, place at 4°C for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes;

[0050] ④ Discard the supernatant, add 1mL 75% ethanol, mix well, and centrifuge at 8500g for 5 minutes ...

Embodiment 2

[0087] Example 2 MG7-NPΔ18+F mut Rescue of labeled vaccine strains

[0088] 1. Experimental method

[0089] 1.1 Mutation of cleavage site of F protein of MG7-NPΔ18 strain and construction of full-length cDNA

[0090] MG7-NPΔ18 and MG7-NP rescued by Example 1 of the present invention mut3 Strain virus virulence is not obviously weakened, therefore, on the basis of the plasmid pMG7-NPΔ18 constructed in Example 1, the present invention mutates the F protein cleavage site, and the F protein cleavage site RRQKRF is mutated to GRQGRL, GRQKRF, RRQGRF respectively and RRQKRL, to obtain the mutant plasmid pMG7-NPΔ18+F mut , pMG7-NPΔ18+F mut-1 , pMG7-NPΔ18+F mut-2 and pMG7-NPΔ18+F mut-3 .

[0091] Primers used to mutate the F protein cleavage site are as follows:

[0092] F7: 5'CTCCGACCAAAACCCCCCACACTCCCTG3';

[0093] R7:5'AGAGTAGAGAAGAATACCCTCCCTGTTGCAG3';

[0094] F8: 5'TCTGTGTCCACGTCTGGAGGAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAG3';

[0095] R8: 5'CTGCCAATAACAGCACCTATAAGGCGC...

Embodiment 3

[0127] Example 3 MG7-NPΔ18+F mut Experiment of immune effect of labeled vaccine strains on SPF chickens

[0128] 1. Experimental method

[0129] In order to measure the MG7-NPΔ18+F rescued by Example 2 of the present invention mut Marked vaccine strain (microorganism preservation number is: CCTCC NO: V201505; for the immune protection of 4-week-old SPF chickens, use 9-day-old SPF chicken embryos to amplify the virus, collect allantoic fluid, and measure the EID of the marked vaccine strain 50 5.62×10 9 / mL, when preparing a vaccine, the virus was diluted to 3.16×10 9 / mL.

[0130] The virus is inactivated after dilution. The specific operation is: first dilute the analytically pure formaldehyde (no crystal) solution with sterilized physiological saline at 1:10, then add the diluted formaldehyde solution to the virus solution, and shake it while adding it. The final concentration of formaldehyde solution is 0.15% (for example, add 1 mL of formaldehyde solution diluted 1:10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a gene-VII type Newcastle disease virus-marked vaccine strain and an application thereof, and belongs to the field of rescue and application of the gene-VII type Newcastle disease virus-marked vaccine strain. The present invention uses the established Newcastle disease virus reverse genetics operation platform to delete 18 amino acids from the NP protein of the G7 strain and mutate the cleavage site of the F protein, and rescue a strain with highly weakened virulence and high virus titer through screening. High gene type VII Newcastle disease virus marker vaccine strain MG7‑NPΔ18+Fmut, its microbial deposit number is: CCTCC NO: V201505. The labeled vaccine strain of the present invention has the biological characteristics of high growth titer and low pathogenicity in chicken embryos and is genetically stable. The results of the immune protection test show that the labeled vaccine strain has good immunogenicity, can induce a high level of protective antibodies, and can completely protect the immunized chickens. Vaccine immunization and wild virus infection lay the foundation.

Description

technical field [0001] The present invention relates to gene type VII Newcastle disease virus, in particular to gene type VII Newcastle disease virus marker vaccine strain MG7-NPΔ18+F mut , the present invention also relates to said MG7-NPΔ18+F mut The application of the strain in the preparation of the gene type VII Newcastle disease vaccine belongs to the field of rescue and application of the gene type VII Newcastle disease virus marker vaccine strain. Background technique [0002] Newcastle disease is an acute and highly contagious poultry disease caused by Newcastle Disease Virus (NDV), which mainly affects chickens and turkeys. It is recognized as one of the two most important poultry infectious diseases in the world. [0003] At present, two attenuated vaccines or inactivated vaccines, LaSota and Hitcher B1, are mainly used in the prevention and control of Newcastle disease, and they have been used as vaccine strains for decades. Both LaSota and Hitcher B1 strains b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/00A61K39/17A61P31/14C12R1/93
Inventor 朱启运吉艳红付钰广
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap