Method for improving solubility of foot-and-mouth disease protein for immunization
A foot-and-mouth disease, soluble technology, applied in the direction of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve problems such as different solubility effects, protein insolubility, and unstable improvement effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0056] The main principle of the method for improving the solubility of foot-and-mouth disease protein provided by the present invention is to increase the solubility of foot-and-mouth disease protein by increasing the His6-MBP tag at the end (C-terminus) of the foot-and-mouth disease protein during related gene manipulation. The preferred solution is to increase the His6- MBP-TEV tag, which facilitates the digestion of related proteins.
[0057] In this embodiment, based on the above method, a specific foot-and-mouth disease recombinant protein CDG276 was prepared, expressed as follows: NdeI-Extag-Sitag3-NheI-YPYDVPDYA-ENLYFQ-BamHI-FMDVA1-XhoI; the specific base sequence is as follows (or as shown in SEQ ID NO.1).
[0058] CATATGACAGATGTAACGATTAAAGACTCTGCTCGTGGTTTCAAAAAACCGGGTAAACGTGCTAGCTACCCGTACGACGTTCCGGACTACGCTGAAAACCTGTACTTCCAAGGATCCACCACCGCTACCGGTGAATCTGCTGACCCGGTTACCACCACCGTTGAAAACTACGGTGGTGAAACCCAGGTTCAGCGTCGTTACCACACCGACGTTGGTTTCCTGATGGACCGTTTCGTTCAGATCAAACCGGTTGGTCC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com