Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving solubility of foot-and-mouth disease protein for immunization

A foot-and-mouth disease, soluble technology, applied in the direction of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve problems such as different solubility effects, protein insolubility, and unstable improvement effects

Inactive Publication Date: 2015-11-04
HENAN AGRICULTURAL UNIVERSITY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Relatively speaking, the technical difficulties of protein expression and purification are relatively easy to overcome, while the soluble expression of proteins is a technical bottleneck
The cause and mechanism of protein insolubility are still in the exploratory stage, but it is generally believed that two factors lead to protein insolubility: one is the rate of protein translation, and the other is the rate of protein folding
[0005] In the existing research, one way to improve the solubility of protein expression is to improve the solubility of protein expression by expressing strains and changing the expression conditions, but the effect is sometimes not ideal, and due to the existence of inclusion bodies, the improvement effect of this way is unstable; another important and effective method is to add a soluble tag at the end of the active protein, through the fusion of the soluble tag and the target protein, and through the folding of the tag itself to increase the solubility of the target protein
However, different soluble tags can improve the solubility of different active proteins differently, and since soluble tags often need to be further removed in the later stage, it is often necessary to choose the most suitable soluble tag for different active proteins. Is the key, but also difficult work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving solubility of foot-and-mouth disease protein for immunization
  • Method for improving solubility of foot-and-mouth disease protein for immunization
  • Method for improving solubility of foot-and-mouth disease protein for immunization

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0056] The main principle of the method for improving the solubility of foot-and-mouth disease protein provided by the present invention is to increase the solubility of foot-and-mouth disease protein by increasing the His6-MBP tag at the end (C-terminus) of the foot-and-mouth disease protein during related gene manipulation. The preferred solution is to increase the His6- MBP-TEV tag, which facilitates the digestion of related proteins.

[0057] In this embodiment, based on the above method, a specific foot-and-mouth disease recombinant protein CDG276 was prepared, expressed as follows: NdeI-Extag-Sitag3-NheI-YPYDVPDYA-ENLYFQ-BamHI-FMDVA1-XhoI; the specific base sequence is as follows (or as shown in SEQ ID NO.1).

[0058] CATATGACAGATGTAACGATTAAAGACTCTGCTCGTGGTTTCAAAAAACCGGGTAAACGTGCTAGCTACCCGTACGACGTTCCGGACTACGCTGAAAACCTGTACTTCCAAGGATCCACCACCGCTACCGGTGAATCTGCTGACCCGGTTACCACCACCGTTGAAAACTACGGTGGTGAAACCCAGGTTCAGCGTCGTTACCACACCGACGTTGGTTTCCTGATGGACCGTTTCGTTCAGATCAAACCGGTTGGTCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the technical field of preparation of a vaccine, and particularly relates to a method for improving the solubility of a foot-and-mouth disease protein for immunization. The method is by adding an His6-MBP protein tag in the C terminal of the foot-and-mouth disease protein by the mean genetic engineering in FMD protein by genetic engineering, so as to increase the solubility of the foot-and-mouth disease protein; the His6 represents the 6 histidine tags, and MBP represents a maltase binding protein. The present invention also provides an immune FMD protein CDG276 aiming at type A FMD prepared by the method. Compared to the FMDV VPI protein prepared by the existing genetic engineering, the FMD protein prepared by the invention has obvious increased the expression level; and due to the addition of soluble label maltose binding protein (MBP), the expressed FMDVA1 soluble protein has significantly increased solubility; therefore, the method has good application value.

Description

technical field [0001] The invention belongs to the technical field of vaccine preparation, and in particular relates to a method for improving the solubility of foot-and-mouth disease protein for immunity. Background technique [0002] Foot-and-mouth disease (FMD) is a severe contact infectious disease of cloven-hoofed animals caused by foot-and-mouth disease virus (FMDV), which mainly harms cattle, sheep, pigs, etc. It can cause a large-scale epidemic in the group and cause serious economic losses. The World Organization for Animal Health (OIE) classifies it as a notifiable disease, and the Ministry of Agriculture of my country also classifies it as a first-class animal infectious disease. The currently known FMDV includes A, O, C, Asia 1, SAT 1, SAT2 and SAT 3 serotypes without cross-immune protection, and more than 60 subtypes have been formed in the long-term mutual transmission infection. [0003] With the development of modern molecular biology technology, the resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/42C07K14/09
Inventor 杨国宇舒静超王月影耿娟李和平朱河水钟凯鲁维飞韩立强王江申欢欢刘起涛
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products