Saccharomyces cerevisiae chromosome as well as construction method and application thereof

A technology of Saccharomyces cerevisiae and artificial chromosome, applied in the direction of microorganism-based methods, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc., can solve the problem of small number of genes, low product expression, difficult to meet industrial mass production, etc. problem, to achieve the effect of improving the expression

Active Publication Date: 2015-11-25
TSINGHUA UNIV +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, one limitation of integration into chromosomes is that the copy number of genes that can be integrated is low, and the number of genes that can be integrated is small, so the product expression is small, and it is difficult to meet the purpose of industrial mass production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae chromosome as well as construction method and application thereof
  • Saccharomyces cerevisiae chromosome as well as construction method and application thereof
  • Saccharomyces cerevisiae chromosome as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Embodiment 1, the preparation method of yeast chromosome

[0077] 1. Acquisition of yeast strains containing pNEOC14 vector

[0078] 1. Acquisition of pNEOC1 vector

[0079] (1) According to the natural telomere structure of Saccharomyces cerevisiae, a DNA fragment with telomere repeat sequence and Xcore was designed, and the pUC19-F126 vector was synthesized by commercial gene synthesis. The pUC19-F126 vector was double digested with restriction endonucleases BsaI and AgeI, and a 770bp fragment was recovered, which was the DNA fragment of the telomeric repeat sequence and Xcore. The nucleotide sequence of the fragment was shown in the sequence listing Sequence 1 is shown.

[0080] (2) Using pRS414 with the BsaI and BsmBI restriction sites removed as a template, primer 1 (GCACCGGTTTCCCCCGAAAAGTGCCACCT) and primer 2 (TAGGTCTCTTGTGTTTAAACATGTGCGCGGAACCCCTATTT) were used for PCR amplification using pfu enzyme to obtain a PCR amplification product with a size of 4816bp, n...

Embodiment 2

[0132] Embodiment 2, the application of yeast chromosome in the production of beta carotene

[0133] 1. Synthesis of target fragments

[0134]The DNA fragment shown in sequence 17 in the sequence list is artificially synthesized, and the fragment is sequentially terminated by URR1, TDH3 promoter, crtE gene, TEF1 terminator, ADH1 promoter, crtI gene, ADH1 terminator, TEF2 promoter, crtYB gene, and TEF2 Son, LEU2 (screening marker gene) and URR2 composition. All promoters, genes, and terminators are seamlessly connected.

[0135] 2. Conversion

[0136] Transform the DNA fragment shown in sequence 17 in the sequence listing synthesized in step 1 into the yeast strain prepared in Example 1 containing a repeated recombination cassette, and use yeast homologous recombination to obtain a correctly integrated yeast strain. and identified by PCR. The steps of PCR identification are as follows:

[0137] Use the genomic DNA of the transformant as a template, and use PrimerA and Prim...

Embodiment 3

[0155] Example 3, the application of yeast chromosome in the production of violacein

[0156] 1. Synthesis of target fragments

[0157] The DNA fragment shown in sequence 18 in the sequence list is artificially synthesized, and the fragment is sequentially terminated by URR1, TEF2 promoter, vioA gene, ADH1 terminator, TEF2 promoter, vioB gene, ADH1 terminator, TEF2 promoter, vioC gene, and ADH1 promoter, TEF2 promoter, vioD gene, ADH1 terminator, TEF2 promoter, vioE gene, ADH1 terminator, LEU2 (selectable marker gene) and URR2. All promoters, genes, and terminators are seamlessly connected.

[0158] 2. Conversion

[0159] Transform the DNA fragment shown in sequence 18 in the sequence listing synthesized in step 1 into the yeast strain containing the repeated recombination cassette prepared in Example 1, and use yeast homologous recombination to obtain a correctly integrated yeast strain. and identified by PCR. The steps of PCR identification are as follows:

[0160] Use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae chromosome as well as a construction method and application thereof. The saccharomyces cerevisiae chromosome comprises two telomeric repeat sequences, two insulator sequences, a centromere-autonomously replicating sequence, a po130 gene and n repeated recombination boxes. Experiment results prove that auxotrophic marker genes of the saccharomyces cerevisiae chromosome are few, normal and stable growth in the situation that screening is not carried out can be realized, the expression quantity and copy number of exogenous genes in yeast are increased, the stability of exogenous genes in yeast is improved, genes integrated into a genome can be increased or reduced, and even expanded into new polygene clusters, and the rapid exogenous expression of beta carotene and violacein is successfully realized in yeast, so that a rapid feasible method is provided for yeast heterogeneous production of various exogenous approaches, and the saccharomyces cerevisiae chromosome can meet the application requirements of fields of gene engineering, metabolic engineering and synthetic biology.

Description

technical field [0001] The invention belongs to the fields of genetic engineering, metabolic engineering and synthetic biology, and specifically relates to a Saccharomyces cerevisiae chromosome and its construction method and application; in particular, it relates to a chromosome that can realize multiple genes, multiple metabolic pathways, is expandable, does not require screening, and exists stably Saccharomyces cerevisiae chromosome and its construction method and application. Background technique [0002] With the development of modern biotechnology and biomedicine, the use of exogenous systems to express and obtain high value-added products is becoming more and more common. Famous successful cases include the fermentation production of artemisinin, etc. Traditional expression systems use microorganisms such as Escherichia coli, Bacillus subtilis, and Saccharomyces cerevisiae, etc., to obtain the desired target by putting enzyme genes that do not exist in these systems,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/11C12N1/19C12R1/865
Inventor戴俊彪林继伟吴庆余董俊凯
OwnerTSINGHUA UNIV