Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection kit for chicken infectious bronchitis indirect ELISA antibody

A bronchitis, chicken infectious technology, applied in the field of chicken infectious bronchitis indirect ELISA antibody detection kit

Inactive Publication Date: 2015-11-25
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the N-terminal portion of the IBV nucleoprotein expressed in a prokaryotic system is more specific in antigenicity, and the research and application of using this specific protein in antigen detection for antibody detection has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for chicken infectious bronchitis indirect ELISA antibody
  • Detection kit for chicken infectious bronchitis indirect ELISA antibody
  • Detection kit for chicken infectious bronchitis indirect ELISA antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1E

[0055] The preparation of embodiment 1 ELISA plate coating antigenic protein

[0056] The IBV strain used in this example is ck / CH / LJL / 04I strain; the cloning vector pMD18-Tvector (purchased from TaKaRa Company), and the expression vector is pGEX-6p-1.

[0057] 1.1 Through the analysis of the N protein epitope of the IBVCK / CH / LJL04I strain, select the 1-480bp fragment of the N gene as N1, 433-1230bp as N2, and 1-1230bp as N, and design primers to express N1, N2 and N For these three proteins, the total RNA of the IBVck / CH / LJL04I strain was first extracted by the Trizol method, and reverse-transcribed by One-stepPCR. The N1, N2, and N primers were as follows:

[0058] N1F: 5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'

[0059] N1R: 5'GCGTCGACTTACAGAGGAATAAAATCCCAACGG3'

[0060] N2F: 5'CGCGGATCCATGTCAGATGGAGGACCTGACGG3'

[0061] N2R: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'

[0062] NF:5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'

[0063] NR: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'

[0064] The amplifi...

Embodiment 3

[0074] The optimization of embodiment 3 antigen protein

Embodiment 2

[0075] In Example 2, N1-GST (N160) has been preliminarily determined as a candidate antigen protein for infectious bronchitis virus detection. In order to determine that the selected protein is the best recombinant protein, N140 and N180 recombinant proteins were constructed for comparison with N160 recombinant protein. The purified recombinant proteins N140, N160 and N180 were respectively reacted with infectious bronchitis virus positive sera, and the specificity of each fusion protein reacting with the positive sera was verified according to the western-blot method. The result is as Figure 8 It shows that the western-blot verification shows that the N140, N160 and N180 fusion proteins can all react with the positive serum of infectious bronchitis virus, but the N180 recombinant protein reacts with the positive serum with non-specific bands, and the N140 recombinant protein has weak reactivity with the positive serum , while the N160 recombinant protein reacted with positiv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection kit for chicken infectious bronchitis indirect ELISA antibody, belonging to the field of biotechnology. According to the invention, genetically engineered bacterium capable of steadily expressing partial nucleoprotein of chicken infectious bronchitis virus is utilized for inducible expression of recombined N160 protein which is subjected to affinity chromatographic purification, and the purified recombined N160 protein is taken as a coating antigen, so as to establish a simple and convenient and specific indirect ELISA method. The invention further provides a specific, sensitive, quick and convenient-to-operate kit for detecting the antibody of the chicken infectious bronchitis virus, which can be used for quickly diagnosing whether the chicken flocks are infected by the chicken infectious bronchitis virus and monitoring the immune chicken serum antibody level and the chicken maternal antibody level in actual production, so as to evaluate the degree of risk that the chicken flocks are infected by the infectious bronchitis virus and provide reference for the formulation of an infectious bronchitis immune procedure.

Description

technical field [0001] The invention relates to an indirect ELISA antibody detection kit for chicken infectious bronchitis, which belongs to the field of biotechnology. Background technique [0002] Chicken infectious bronchitis (Infectious Bronchitis, IB) is an acute, highly contagious respiratory infectious disease of chickens caused by infectious bronchitis virus (IBV). one of the major diseases. Vaccine immunization is the most effective way to prevent and control the occurrence of chicken infectious bronchitis, and the level of antibody after immunization reflects the actual vaccine immunity effect, which is directly related to the resistance of immunized chickens to chicken infectious bronchitis virus. The virus antibody in the serum of chickens immunized with chicken infectious bronchitis vaccine can be detected by enzyme-linked immunosorbent assay (ELISA). immune status. The level of IBV antibody (mainly including IgG) in the serum and the immune status of the who...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569
CPCG01N33/56983
Inventor 刘胜旺张宇韩宗玺
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI