Detection kit for chicken infectious bronchitis indirect ELISA antibody
A bronchitis, chicken infectious technology, applied in the field of chicken infectious bronchitis indirect ELISA antibody detection kit
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1E
[0055] The preparation of embodiment 1 ELISA plate coating antigenic protein
[0056] The IBV strain used in this example is ck / CH / LJL / 04I strain; the cloning vector pMD18-Tvector (purchased from TaKaRa Company), and the expression vector is pGEX-6p-1.
[0057] 1.1 Through the analysis of the N protein epitope of the IBVCK / CH / LJL04I strain, select the 1-480bp fragment of the N gene as N1, 433-1230bp as N2, and 1-1230bp as N, and design primers to express N1, N2 and N For these three proteins, the total RNA of the IBVck / CH / LJL04I strain was first extracted by the Trizol method, and reverse-transcribed by One-stepPCR. The N1, N2, and N primers were as follows:
[0058] N1F: 5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'
[0059] N1R: 5'GCGTCGACTTACAGAGGAATAAAATCCCAACGG3'
[0060] N2F: 5'CGCGGATCCATGTCAGATGGAGGACCTGACGG3'
[0061] N2R: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'
[0062] NF:5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'
[0063] NR: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'
[0064] The amplifi...
Embodiment 3
[0074] The optimization of embodiment 3 antigen protein
Embodiment 2
[0075] In Example 2, N1-GST (N160) has been preliminarily determined as a candidate antigen protein for infectious bronchitis virus detection. In order to determine that the selected protein is the best recombinant protein, N140 and N180 recombinant proteins were constructed for comparison with N160 recombinant protein. The purified recombinant proteins N140, N160 and N180 were respectively reacted with infectious bronchitis virus positive sera, and the specificity of each fusion protein reacting with the positive sera was verified according to the western-blot method. The result is as Figure 8 It shows that the western-blot verification shows that the N140, N160 and N180 fusion proteins can all react with the positive serum of infectious bronchitis virus, but the N180 recombinant protein reacts with the positive serum with non-specific bands, and the N140 recombinant protein has weak reactivity with the positive serum , while the N160 recombinant protein reacted with positiv...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap