Detection kit for chicken infectious bronchitis indirect ELISA antibody
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A bronchitis, chicken infectious technology, applied in the field of chicken infectious bronchitis indirect ELISA antibody detection kit
Inactive Publication Date: 2015-11-25
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the N-terminal portion of the IBV nucleoprotein expressed in a prokaryotic system is more specific in antigenicity, an
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1E
[0055] The preparation of embodiment 1 ELISA plate coating antigenic protein
[0056] The IBV strain used in this example is ck / CH / LJL / 04I strain; the cloning vector pMD18-Tvector (purchased from TaKaRa Company), and the expression vector is pGEX-6p-1.
[0057] 1.1 Through the analysis of the N protein epitope of the IBVCK / CH / LJL04I strain, select the 1-480bp fragment of the N gene as N1, 433-1230bp as N2, and 1-1230bp as N, and design primers to express N1, N2 and N For these three proteins, the total RNA of the IBVck / CH / LJL04I strain was first extracted by the Trizol method, and reverse-transcribed by One-stepPCR. The N1, N2, and N primers were as follows:
[0058] N1F: 5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'
[0059] N1R: 5'GCGTCGACTTACAGAGGAATAAAATCCCAACGG3'
[0060] N2F: 5'CGCGGATCCATGTCAGATGGAGGACCTGACGG3'
[0061] N2R: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'
[0062] NF:5'CGCGGATCCATGGCGAGCGGTAAAGCAAC3'
[0063] NR: 5'GCGTCGACTTATCAAAGTTCATTTTCACCAAG3'
[0064] The amplifi...
Embodiment 3
[0074] The optimization of embodiment 3 antigen protein
Embodiment 2
[0075] In Example 2, N1-GST (N160) has been preliminarily determined as a candidate antigen protein for infectious bronchitis virus detection. In order to determine that the selected protein is the best recombinant protein, N140 and N180 recombinant proteins were constructed for comparison with N160 recombinant protein. The purified recombinant proteins N140, N160 and N180 were respectively reacted with infectious bronchitis virus positive sera, and the specificity of each fusion protein reacting with the positive sera was verified according to the western-blot method. The result is as Figure 8 It shows that the western-blot verification shows that the N140, N160 and N180 fusion proteins can all react with the positive serum of infectious bronchitis virus, but the N180 recombinant protein reacts with the positive serum with non-specific bands, and the N140 recombinant protein has weak reactivity with the positive serum , while the N160 recombinant protein reacted with positiv...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a detection kit for chicken infectious bronchitis indirect ELISA antibody, belonging to the field of biotechnology. According to the invention, genetically engineered bacterium capable of steadily expressing partial nucleoprotein of chicken infectious bronchitis virus is utilized for inducible expression of recombined N160 protein which is subjected to affinity chromatographic purification, and the purified recombined N160 protein is taken as a coating antigen, so as to establish a simple and convenient and specific indirect ELISA method. The invention further provides a specific, sensitive, quick and convenient-to-operate kit for detecting the antibody of the chicken infectious bronchitis virus, which can be used for quickly diagnosing whether the chicken flocks are infected by the chicken infectious bronchitis virus and monitoring the immune chicken serum antibody level and the chicken maternal antibody level in actual production, so as to evaluate the degree of risk that the chicken flocks are infected by the infectious bronchitis virus and provide reference for the formulation of an infectious bronchitis immune procedure.
Description
technical field [0001] The invention relates to an indirect ELISA antibody detection kit for chicken infectious bronchitis, which belongs to the field of biotechnology. Background technique [0002] Chicken infectious bronchitis (Infectious Bronchitis, IB) is an acute, highly contagious respiratory infectious disease of chickens caused by infectious bronchitis virus (IBV). one of the major diseases. Vaccine immunization is the most effective way to prevent and control the occurrence of chicken infectious bronchitis, and the level of antibody after immunization reflects the actual vaccine immunity effect, which is directly related to the resistance of immunized chickens to chicken infectious bronchitis virus. The virus antibody in the serum of chickens immunized with chicken infectious bronchitis vaccine can be detected by enzyme-linked immunosorbent assay (ELISA). immune status. The level of IBV antibody (mainly including IgG) in the serum and the immune status of the who...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more
IPC IPC(8): G01N33/569
CPCG01N33/56983
Inventor 刘胜旺张宇韩宗玺
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Login to view more 
Login to view more