Method for improving plant saccharification efficiency and application of method

A technology for saccharification efficiency and plant sugar, which can be applied in the directions of botanical equipment and methods, applications, and plant products, and can solve problems such as affecting saccharification efficiency.

Active Publication Date: 2015-12-02
SOUTH CHINA AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Xylan improves the toughness and stress resistance of plants by cross-linking with cellulose and lignin in the secondary wall of plants, but the presence of xylan also has a great impact on the industrial application of lignocellulose , the cross-linked network structure formed by xylan around the cellulose prevents the entry of cellulolytic enzymes and affects the saccharification efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving plant saccharification efficiency and application of method
  • Method for improving plant saccharification efficiency and application of method
  • Method for improving plant saccharification efficiency and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Bioinformatic analysis of six UXS proteins in Arabidopsis. Using DNAMAN software to analyze the homology of the amino acid sequence of AtUXS (SEQIDNO: 2, 4, 6, 8, 10, 12), it is found that the amino acid sequence similarity of AtUXS3, AtUXS5 and AtUXS6 is: 91.97%; AtUXS1, AtUXS2 and AtUXS4 amino acid The sequence similarity is: 75.94%, and the similarity between the two groups is relatively small ( figure 1 ). Furthermore, the transmembrane regions of the six AtUXS proteins were predicted (TMHMM, http: / / www.cbs.dtu.dk / services / TMHMM / ), AtUXS1, AtUXS2 and AtUXS4 have transmembrane regions and are located in the Golgi apparatus, AtUXS3, The three proteins AtUXS5 and AtUXS6 have no transmembrane region and may be localized in the cytoplasm ( figure 2 ).

Embodiment 2

[0039] The subcellular localization of 6 AtUXS was carried out by tobacco injection method. The cDNA sequences of 6 ATUXS (SEQ ID NO: 1, 3, 5, 7, 9, 11) were amplified with the primers shown in Table 1 respectively.

[0040] Table 1 Amplifies the primers of the cDNA sequences of 6 ATUXS

[0041] name

[0042] Six AtUXS were constructed into the plant expression vector pEarlyGate101 (ABRC, Arabidopsis Biological Resource Center) by using Gateway technology, and AtUXS could be fused with YFP for expression because the stop codon was removed. The constructed vector was transformed into Agrobacterium agrobacterium C58 (Agrobactreium tumefaciens C58) (purchased from Shanghai Dingguo Biotechnology Co., Ltd.), and subcellular localization was carried out by tobacco injection. Three proteins AtUXS3, AtUXS5 and AtUXS6 were directly injected into tobacco leaves, and three proteins AtUXS1, AtUXS2 and AtUXS4 were co-injected with Golgi Marker CD3-968 (purchased from ABRC, Arabi...

Embodiment 3

[0044]Acquisition of AtUXS-mutated T-DNALine. 从ABRC(ArabidopsisBiologicalResourceCenter)订购到6个AtUXS的突变体:uxs1(N555603,Salk_055603,sixthintron),uxs2(N503691,Salk_003691,firstexon),uxs3(N907654,WiscDsLoxHs080_09,fifthexon),uxs4(N609630,Salk_109630,fifthintron), uxs5(N850623, WiscDsLox293-296invD4, eighthintron) and uxs6(N678548, salk_058602, secondintron)( Figure 4 A). In SALK (SalkInstituteGenomicAnalysisLaboratory, http: / / signal.salk.edu ) website to synthesize corresponding T-DNALine identification primers, as shown in Table 2.

[0045] Table 2 T-DNALine Identification Primers

[0046] Primer Codes

Primer sequence 5′→3′

N555603F

CTGAATTGCTCTATCCAACGG

N555603R

TCACAATGCTTGAACTTGCAG

N503691F

CAAGAAAACATGCACGTGTTG

N503691R

CTTACTCGGATCCTTTCTCCG

N907654F

TGATAGGGCCAGTATCATTGC

N907654R

GCTTCATTGGTTCTCACTTGG

N609630F

GGTCCTTTAATCGTACGGCTC

N609630R

ACCAAGGTTAAATGGACCGAC

N850...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving plant saccharification efficiency and application of the method, and belongs to the field of biomass energy. The plant saccharification efficiency is improved by mutation or lowering of UXS genes of plants. By the method, the content of xylose is reduced, relative content of cellulose is increased correspondingly, the saccharification efficiency of a mutant material can be improved owing to reduction of the content of the xylose, and the material treatment cost is reduced. Therefore, biomass characteristics of the material are changed fundamentally, the saccharification efficiency is improved fundamentally, energy can be saved, and labor intensity is reduced. Materials obtained by the method can be used in biomass conversion, pulp and paper manufacturing industry.

Description

technical field [0001] The invention belongs to the field of biomass energy, and specifically relates to the use of biotechnology to down-regulate the activity of uridinedioic acid glucuronate decarboxylase (UDP-Glucuronicaciddecarboxylase, UXS) in plants. The plants after UXS down-regulation have higher saccharification efficiency. The invention relates to Use of UXS down-regulated plants in various applications such as biomass conversion, pulp and paper industry; particularly relates to a method for increasing plant saccharification efficiency and its use. Background technique [0002] Biomass energy is the fourth largest energy source in the world, second only to oil, coal and natural gas. Because it comes from the photosynthesis of plants, it can be transformed in solid, liquid and gaseous states. It can be described as inexhaustible, renewable energy and environmentally friendly. The world today mainly uses traditional energy, which has limited storage, non-renewable e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00
Inventor吴蔼民赵先海匡倍庆周纯陈晓阳
OwnerSOUTH CHINA AGRI UNIV