Building method and application of STCH gene knock-out animal model

A gene knockout and animal model technology, applied in the field of genes, can solve the problems of lack of carboxy-terminal peptide binding domain, lack of

Active Publication Date: 2015-12-02
TONGJI UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is currently proved that STCH is in the cavity of the endoplasmic reticulum (ER), but lacks a consistent carboxy-terminal resident sequence, which is the subcellular structural location of the gene; the N-terminus of stress and heat shock proteins contains a unique hydrophobic leader peptide sequence, which consists of 22 amino acid residues, but unlike other heat shock proteins, it lacks the binding domain of the carboxy-terminal peptide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building method and application of STCH gene knock-out animal model
  • Building method and application of STCH gene knock-out animal model
  • Building method and application of STCH gene knock-out animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] STCH gene knockout animal model construction method, STCH conditional gene knockout mouse is through the strategy of gene targeting, inserting LoxP sites in the same direction at both ends of exon 2 of STCH gene, when the mouse is introduced into Cre recombinase In some cases, Cre recombinase recognizes the LoxP site and excises the sequence between the LoxP sites to achieve the purpose of conditionally deleting the STCH gene in specific cells. Include the following steps:

[0060] 1) Cultivate CJ7 embryonic stem cells derived from 129SV / J strain male mice on mouse embryonic fibroblast trophoblasts, and collect STCH gene knockout embryonic stem cells that are mutated by targeting vectors targeting exon 2 of the STCH gene ,

[0061] 2) Preparation of mouse donor blastocysts,

[0062] 3) Inject STCH knockout embryonic stem cells into the mouse donor blastocyst,

[0063] 4) Transplantation of blastocyst-formed embryos containing STCH-knockout embryonic stem cells into t...

Embodiment 2

[0088] The phenotypes of the STCH+ / - mice (ie STCH gene heterozygous knockout mice) prepared in Example 1 were identified. STCH+ / - mice (ie STCH gene heterozygous knockout mice) were produced by the method in Example 1; STCH- / - mice (ie STCH gene homozygous knockout mice) were embryonic lethal. STCH+ / + mice: normal control mice.

[0089] 1. Detection of the genotype of newborn mice by PCR (using routine operation means)

[0090] Primer sequences, PAGE purification (Table 1).

[0091] Table 1 STCH gene sequence of mouse

[0092] Primer name

Primer sequence (5'-3')

KO P1

GGATGATCTGGACGAAGAGC

Common P2

GGGGGTAAGGTCTGGAATGT

STCH+ / + P3

AAAACGGGCATATCAGCATC

[0093] Electrophoresis band size: STCH+ / +: 904bp, STCH+ / -: 1372bp, CKO2000bp

[0094] The PCR kit was purchased from Takala (Code: D333)

[0095] 2. Western Blot detection of STCH gene expression in STCH+ / - and normal mouse brains (using conventional methods)

[0096] G...

Embodiment 3

[0101] Behavioral test of STCH+ / + mice and STCH+ / - mice

[0102] Including the following experiments: rotarod behavior experiment, tail suspension behavior experiment, forced swimming behavior experiment, open field behavior experiment, water maze behavior experiment. The experimental method adopts conventional method or standard method.

[0103] From image 3 According to the analysis of the results, the motor coordination ability of STCH+ / - mice was poorer than that of STCH+ / + mice at any age. And this significant difference began to appear when the age of the mice was two months, and then as the months increased, the motor coordination ability of the two groups of mice gradually increased and reached the peak at the age of six months, and then increased with the age of the mice. growth, the ability shows a gradual decline.

[0104] From Figure 4 According to the analysis of the results, the depression degree of STCH+ / - mice was significantly stronger than that of STCH+...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a building method and application of an STCH (stress and chaperone) gene knock-out animal model. The model can function as an animal model for the research of occurrence of depression and / or dementia. The model is prepared by using a gene knock-out technique, animal behavior detections show that a mouse suffers depression-like symptoms (forced swimming test and tail suspension test) and memory dysfunction (water maze test) while it grows older and has depression and dementia-like symptoms, and the model is applicable to screening anti-depression and anti-dementia drugs.

Description

technical field [0001] The invention relates to the field of gene technology, in particular to a construction method and application of an STCH gene knockout animal model. Background technique [0002] Heat shock protein (Heatshockproteins, HSP) is a protein rapidly synthesized by the body under stress conditions, also known as stress protein. Members of this family are involved in the folding, assembly and transport of proteins in organisms as molecular chaperones, but not in the final protein assembly. In addition to functioning as non-specific molecular chaperones, heat shock proteins also participate in the protection system of cells. On the one hand, they can stabilize the cell structure by rapidly clearing the protein that loses function in the cell, and can also make the cell heat-tolerant. There are many types of this protein family, and there are subtle differences in function. Scientists divide heat shock proteins into four families based on protein molecular we...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027A61K49/00A61K45/00A61P25/24A61P25/28
Inventor徐国彤吕立夏
OwnerTONGJI UNIV