CRISPR/Cas9 single transcription unit directionally modified backbone vector and application thereof

A backbone vector and a single technology, applied in the field of genetic engineering, can solve the problems of difficult to achieve Cas9 protein expression and gRNA transcription synergy, limited CRISPR/Cas9 work efficiency and application scope, difficult to achieve spatiotemporal specificity and induced transcriptional regulation and other problems

Active Publication Date: 2015-12-09
UNIV OF ELECTRONICS SCI & TECH OF CHINA
View PDF4 Cites 48 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, in the above CRISPR/Cas9 genome editing system, there are inherent defects in the design of the independent Cas9 protein expression unit and gRNA transcription unit, and it is difficult to achieve synergy between Cas9 protein expression and gRNA transcription
At the same time, since the transcription of gRNA units basically depends on PolIII-type promoters su

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 single transcription unit directionally modified backbone vector and application thereof
  • CRISPR/Cas9 single transcription unit directionally modified backbone vector and application thereof
  • CRISPR/Cas9 single transcription unit directionally modified backbone vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Construction of CRISPR / Cas9 Single Transcription Unit Skeleton Vector

[0052] The present invention designs a CRISPR / Cas9 single transcription unit skeleton carrier for genome engineering, and its core unit is composed of a PolII type promoter (the scheme of the basic CRISPR / Cas9 single transcription unit skeleton carrier can be cut by AscI and SbfI to realize different Replacement of PolII type promoter), Cas9 protein coding frame (including NLS sequence), PolyA sequence, ribozyme recognition site (RZcleavagesite), gRNA clone and transcription unit (including BsaI-ccdB-BsaI unit), ribozyme recognition site (RZcleavagesite), ribozyme (holozyme) (RiboZyme) constituted in sequence. CRISPR / Cas9 single transcription unit structure and working principle see figure 1 .

[0053] Optionally, the backbone vector also includes: the left and right border sequences of T-DNA, and the PolII promoter drives the single transcription unit "Cas9-polyA-RZcleavagesite-gRNAclo...

Embodiment 2

[0056] Example 2, Site-directed genetic modification of rice endogenous gene OsYSA based on CRISPR / Cas9 single transcription unit system

[0057] 1. Design of rice OsYSA gene target gRNA and construction of Cas9-gRNA recombinant expression vector

[0058] Based on the rice OsYSA sequence (NCBI No. NM001057140) as the reference sequence, according to the 365bp-387bp ( CCG CTTCGGCCGAGGTGGCGCGC, the underline is the PAM structure) and 571bp-593bp ( CCT CATGAAGGTGCTCGTCGCGG, the underline is the PAM structure) region, design OsYSA-gRNA1, OsYSA-gRNA2 (Table 1).

[0059] Table 1 Design, synthesis and detection information of rice OsYSA gene gRNA

[0060]

[0061] According to the designed nucleic acid sequences of OsYSA-gRNA1 and OsYSA-gRNA2 sites, artificially synthesize the corresponding forward and reverse oligonucleotide chains, and the specific sequences are as follows (the uppercase base sequence represents the sequence in which the PAM structure is removed from the des...

Embodiment 3

[0071] Example 3, Site-directed genetic modification of rice endogenous gene OsPDS based on CRISPR / Cas9 single transcription unit system

[0072] 1. Design of rice OsPDS gene target gRNA and construction of pCas9-gRNA expression vector

[0073] Based on the rice OsPDS sequence (NCBI No. NM001055721) as the reference sequence, based on the 1290bp-1312bp (GTTGGTCTTTGCTCCTGCAG AGG, the underline is the PAM structure) region, and OsPDS-gRNA2 was designed (Table 2).

[0074] Table 2 Design, synthesis and detection information of rice OsPDS gene gRNA

[0075]

[0076] According to the designed nucleic acid sequence of the OsPDS-gRNA2 site, artificially synthesize the corresponding forward and reverse oligonucleotide chains, the specific sequence is as follows (the uppercase base sequence represents the sequence in which the PAM structure is removed from the designed gRNA site; the lowercase base sequence represents cohesive end sequences complementary to the backbone vector): ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of gene engineering, and concretely relates to a CRISPR/Cas9 single transcription unit directionally modified backbone vector and an application thereof. Technical problems to be solved in the invention comprise low species versatility and difficult realization of Cas9 protein expression and gRNA transcription cooperation of present CRISPR/Cas9 genome editing systems. A technical scheme in the invention is characterized in that a CRISPR/Cas9 single transcription unit backbone vector is constructed, and transcription of Cas9 and a guide RNA core unit are regulated by a promoter. The invention also provides a method for constructing a target site specifically modified Cas9-gRNA recombinant vector by adopting the CRISPR/Cas9 single transcription unit backbone vector. The efficient CRISPR/Cas9 single transcription unit backbone vector can effectively realize Pol II promoter driving-based Cas9 and gRNA unit cooperative transcription, and also can realize simple, fast and efficient genome directional heredity modification of various eukaryotes.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a CRISPR / Cas9 single transcription unit directional modification backbone carrier and application thereof. Background technique [0002] In recent years, with the advancement of model animal and plant genome sequencing projects and the improvement of related gene manipulation technologies, sequence-specific nucleases (zinc-fingernuclease, ZFN; transcription activator-like effectors nuclease, TALEN; clustered regularly interspaced short palindromic repeats / CRISPR- associatedprotein-9, CRISPR / Cas9), which can cause DSBs at specific sites in the genome of the target organism, and under the action of the endogenous DNA repair system of the organism, different types of directional genetic modification of the target genome can be achieved. [0003] In the CRISPR / Cas9 genome editing system, the specific cleavage of the genome target sequence by CRISPR / Cas9 mainly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/79C12N15/66
Inventor 张勇郑雪莲邓科君唐旭章登位
Owner UNIV OF ELECTRONICS SCI & TECH OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap