Flounder neuropeptide and its application

A neuropeptide and flounder technology, which is applied in the field of protein expression application, can solve the problems such as the lack of biological activity of proteins and the inability of short peptides to exert their activities.

Inactive Publication Date: 2019-04-26
OCEAN UNIV OF CHINA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of prokaryotic expression, it is often encountered that the expressed protein does not have biological activity, especially for some short peptides, which form fusion proteins with tag proteins in the prokaryotic expression system. The existence of tag proteins may cause short peptides to be blocked. In case of being wrapped and unable to exert its activity
Therefore, there have been few successful reports on the in vitro expression of endocrine neuropeptides.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flounder neuropeptide and its application
  • Flounder neuropeptide and its application
  • Flounder neuropeptide and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Screening and sequence analysis of flounder neuropeptides

[0021] 1. Screening of flounder neuropeptides

[0022] The applicant conducted sequence analysis on the flounder genome library data obtained by our laboratory to explore the nucleotide sequence encoding small peptides, and then performed BLAST comparison on the encoded amino acid sequences to screen out the neuroendocrine system-related proteins of interest. Through screening, we found a nucleotide whose sequence is SEQ ID NO: 2, which can encode a small protein with an amino acid sequence of SEQ ID NO: 1. The blastp analysis of the protein containing 127 amino acids found that it is consistent with NCBI Compared with those reported in , the similarity was up to 78%. It was subsequently named flounder neuropeptide according to its function.

Embodiment 2

[0023] Example 2 Construction of recombinant expression vector, identification and expression of neuropeptide

[0024] Construction and identification of the recombinant plasmid: According to the cDNA sequence of the flounder neuropeptide (SEQ ID NO: 2), a pair of specific primers P1 and P2 were used to amplify the coding sequence of the flounder neuropeptide. A restriction endonuclease site Kpn I and a sequence encoding an enterokinase cleavage site are introduced at the 5' end of the P1 primer, and a restriction endonuclease site Sac I and a stop codon coding are introduced at the 5' end of the P2 primer Sequence TCA, the sequences of the two primers are:

[0025] P1: GGTACCGACGACGACGACAAGGCAACAGGATCTGTCCTCTCTGC

[0026] P2: GAGCTCTCAAAAGCGAAGGGTTAACGGGTTGTAGTTG;

[0027] The PCR reaction volume was 25ul, and the amplification conditions were: 94°C for 5min; 35 cycles of 94°C for 30s, 68°C for 30s, and 72°C for 30s; 72°C for 7min. After the PCR product was detected by aga...

Embodiment 3

[0028] Example 3 Expression, purification and functional verification of recombinantly expressed flounder neuropeptide

[0029] 1. Induced expression of recombinant protein:

[0030] The recombinant vector obtained above was introduced into the host strain Transetta (DE3), and the LB medium containing 100ug / mL ampicillin and 34ug / mL chloramphenicol was used for expansion culture, and PCR reaction was carried out with P1 and P2 as primers to screen the transformed into Correctly recombine the engineered strain of the expression vector and perform sequencing to verify that no base mutation occurs.

[0031] Inoculate the single clone of the screened engineered strain in 2×YT culture medium (containing 100ug / mL ampicillin and 34ug / mL chloramphenicol) at 37°C to expand the culture to OD 600 At about 0.6, add the inducer isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 1mM, induce expression at 37°C, and take samples at intervals of 1 hour, and collect the cel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention aims at providing parachthys olivaceus neuropeptide with the amino acid sequence of SEQ ID NO:1. The code sequence of parachthys olivaceus is obtained through cloning, carriers and engineering bacteria which can effectively conduct recombinant expression of the neuropeptide are established and screened out, and the fusion expression of the parachthys olivaceus neuropeptide in prokaryotic organisms is achieved; compared with a traditional polypeptide synthesizing method and a method for extracting polypeptide from natural resources, a preparation method of the parachthys olivaceus neuropeptide has the advantage that it is possible to produce the neuropeptide on a large scale and at a low cost. The obtained engineering bacteria can be directly used as feed additives, the neuropeptide is released under the effect of enterokinase of fishes so that functions of neuropeptide can be achieved, and therefore the parachthys olivaceus neuropeptide can be applied to feed additives and veterinary drugs for mariculture fishes and culture livestock, the long-standing problem that it is difficult to safely, effectively and manually control the sexual maturity process of breed varieties in the breeding industry is solved, and the industry technological advance of the breeding industry and the breeding feed industry is driven in a high-tech mode.

Description

technical field [0001] The invention belongs to the technical field of protein expression application, and in particular relates to a flounder neuropeptide and its application. Background technique [0002] The completion of puberty in vertebrates is marked by the acquisition of reproductive capacity, whereas the initiation of puberty begins with increased secretion of pulsatile gonadotropin-releasing hormone (GnRH) in the hypothalamus. Gonadal development and maturation in fish is tightly controlled by various sex hormone signals in the hypothalamic-pituitary-gonadal axis. As a key factor of this axis, GnRH stimulates the synthesis and release of gonadotropins (luteinizing hormone (LH) and follicular estrogen (FSH)) to stimulate gonads to carry out gametogenesis and steroid synthesis to complete the body's sexual maturation. [0003] Since 2001, more and more studies have shown that the kisspeptin / GPR54 system is an important signal regulating the release of GnRH in the hy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70C12N1/21A61K38/17A61P15/00A23K20/147A23K50/80C12R1/19
CPCA61K38/00C07K14/461
Inventor张全启宋华玉赵海涛李赞王旭波齐洁王志刚于海洋贺艳
OwnerOCEAN UNIV OF CHINA