A metallothionein gene and its application
A technology of metallothionein and genes, applied in the field of genes, can solve the problems of secondary pollution, harmful heavy metal pollution, etc., and achieve the effect of rapid response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Amplification and mutation of metallothionein Te-MTT2 gene and construction and identification of recombinant plasmid pSUMO-Te-MTT2
[0025] Design primers:
[0026] (1) Primers designed for cloning gene Te-MTT2:
[0027] Te-MTT2-F: GGATCCATGGACCTCAAACTCAAAATA
[0028] Te-MTT2-R: CTCGAGTCAGCATTTGCATTCTGAGCA
[0029] (2) Primers designed for gene Te-MTT2 mutation stop codon:
[0030] Primers that mutate the first stop codon
[0031] Tubian-Te-MTT2-F-1: GCAACTGTCAACCTTGTGAAAACTG
[0032] Tubian-Te-MTT2-R-1: CAGTTTTCACAAGGTTGACAGTTGC
[0033] Primer to mutate the second stop codon
[0034] Tubian-Te-MTT2-F-2: CTGAAAATTGCCAATGCAACCCTTG
[0035] Tubian-Te-MTT2-R-2: CAAGGGTTGCATTGGCAATTTTCAG
[0036] The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0037] Using Te-MTT2-F / Te-MTT2-R, a new gene was amplified from Tetrahymena elliotti by PCR technique, and the nucleotide sequence was SEQ ID NO:1. Utilize Tubian-Te-MTT2-F-1 / Tu...
Embodiment 2
[0039] Example 2 In vitro expression and identification of metallothionein gene Te-MTT2
[0040] Transfer the recombinant plasmid pSUMO-Te-MTT2 into Escherichia coli BL21, pick a single colony and culture it in LB liquid medium to the logarithmic growth phase, induce it with IPTG and continue to culture it for 4h, centrifuge at 1000rpm at 4°C for 5min to collect the cells, and the cells Resuspended in PBS buffer, ultrasonically crushed the bacteria with an ultrasonic cell disruptor, collected the whole bacterial liquid and supernatant, and analyzed the expression product by 12% SDS-PAGE, and did not use the protein expressed by the E. coli cell strain induced by IPTG control. The target protein SUMO-Te-MTT2 was expressed and its size was predicted to be 30KD. The results can preliminarily confirm that the expression of SUMO-Te-MTT2 was successful ( image 3 ).
[0041] Western blotting detection of recombinant protein SUMO-Te-MTT2. The whole bacteria and supernatant of BL21...
Embodiment 3
[0042] Example 3 Escherichia coli BL21 / pSUMO and Escherichia coli BL21 / pSUMO-Te-MTT2 to Cd 2+ tolerance analysis
[0043] Transfer Escherichia coli BL21 / pSUMO and Escherichia coli BL21 / pSUMO-Te-MTT2 to LB medium (5 mL) containing 100 μg / mL kanamycin and culture them until OD600 = 0.7, then add IPTG to a final concentration of 0.05 mM , continue to culture for 4h, respectively induce the expression of SUMO-tagged protein and SUMO-Te-MTT2 protein. The two cell strains were transferred to multi-tube LB medium (5mL) respectively, so that the final concentration was OD600=0.1, and at the same time, concentration gradients of Cd were added to the multi-tube culture medium inoculated with these two strains. 2+ , continue to cultivate for 5h, and detect bacterial proliferation.
[0044] Data processing: set three parallels for each group of test samples, and draw the bacterial concentration—test sample Cd 2+ Concentration diagram ( Figure 5 ).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


