Unlock instant, AI-driven research and patent intelligence for your innovation.

A metallothionein gene and its application

A technology of metallothionein and genes, applied in the field of genes, can solve the problems of secondary pollution, harmful heavy metal pollution, etc., and achieve the effect of rapid response

Active Publication Date: 2019-01-15
SHANXI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current chemical and physical chemical methods used to control heavy metal pollution in water will cause pollution transfer, which is easy to cause secondary pollution, and it is difficult to deal with large watershed and low-concentration harmful heavy metal pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A metallothionein gene and its application
  • A metallothionein gene and its application
  • A metallothionein gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Amplification and mutation of metallothionein Te-MTT2 gene and construction and identification of recombinant plasmid pSUMO-Te-MTT2

[0025] Design primers:

[0026] (1) Primers designed for cloning gene Te-MTT2:

[0027] Te-MTT2-F: GGATCCATGGACCTCAAACTCAAAATA

[0028] Te-MTT2-R: CTCGAGTCAGCATTTGCATTCTGAGCA

[0029] (2) Primers designed for gene Te-MTT2 mutation stop codon:

[0030] Primers that mutate the first stop codon

[0031] Tubian-Te-MTT2-F-1: GCAACTGTCAACCTTGTGAAAACTG

[0032] Tubian-Te-MTT2-R-1: CAGTTTTCACAAGGTTGACAGTTGC

[0033] Primer to mutate the second stop codon

[0034] Tubian-Te-MTT2-F-2: CTGAAAATTGCCAATGCAACCCTTG

[0035] Tubian-Te-MTT2-R-2: CAAGGGTTGCATTGGCAATTTTCAG

[0036] The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0037] Using Te-MTT2-F / Te-MTT2-R, a new gene was amplified from Tetrahymena elliotti by PCR technique, and the nucleotide sequence was SEQ ID NO:1. Utilize Tubian-Te-MTT2-F-1 / Tu...

Embodiment 2

[0039] Example 2 In vitro expression and identification of metallothionein gene Te-MTT2

[0040] Transfer the recombinant plasmid pSUMO-Te-MTT2 into Escherichia coli BL21, pick a single colony and culture it in LB liquid medium to the logarithmic growth phase, induce it with IPTG and continue to culture it for 4h, centrifuge at 1000rpm at 4°C for 5min to collect the cells, and the cells Resuspended in PBS buffer, ultrasonically crushed the bacteria with an ultrasonic cell disruptor, collected the whole bacterial liquid and supernatant, and analyzed the expression product by 12% SDS-PAGE, and did not use the protein expressed by the E. coli cell strain induced by IPTG control. The target protein SUMO-Te-MTT2 was expressed and its size was predicted to be 30KD. The results can preliminarily confirm that the expression of SUMO-Te-MTT2 was successful ( image 3 ).

[0041] Western blotting detection of recombinant protein SUMO-Te-MTT2. The whole bacteria and supernatant of BL21...

Embodiment 3

[0042] Example 3 Escherichia coli BL21 / pSUMO and Escherichia coli BL21 / pSUMO-Te-MTT2 to Cd 2+ tolerance analysis

[0043] Transfer Escherichia coli BL21 / pSUMO and Escherichia coli BL21 / pSUMO-Te-MTT2 to LB medium (5 mL) containing 100 μg / mL kanamycin and culture them until OD600 = 0.7, then add IPTG to a final concentration of 0.05 mM , continue to culture for 4h, respectively induce the expression of SUMO-tagged protein and SUMO-Te-MTT2 protein. The two cell strains were transferred to multi-tube LB medium (5mL) respectively, so that the final concentration was OD600=0.1, and at the same time, concentration gradients of Cd were added to the multi-tube culture medium inoculated with these two strains. 2+ , continue to cultivate for 5h, and detect bacterial proliferation.

[0044] Data processing: set three parallels for each group of test samples, and draw the bacterial concentration—test sample Cd 2+ Concentration diagram ( Figure 5 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel metallothionein gene and application thereof. A PCR (polymerase chain reaction) technique is utilized to amplify Tetrahymena elliotti to obtain a new gene; the terminator codon is mutated to obtain a mutant gene Te-MTT2; the mutant gene Te-MTT2 is connected into a vector pSUMO to obtain a recombinant plasmid pSUMO-Te-MTT2 containing the gene; and after Escherichia coli BL21 is transformed, IPTG (isopropyl-beta-D-thiogalactopyranoside) induction is performed, so that the recombinant gene engineering bacterium BL21 / pSUMO-Te-MTT2 expresses the soluble protein SUMO-Te-MTT2. The recombinant gene engineering bacterium BL21 / pSUMO-Te-MTT2 has very high heavy metal stress tolerance and metal ion enrichment capacity under the IPTG induction action, and thus, has wide application prospects in the aspect of treating heavy metal pollution in aquatic environments.

Description

technical field [0001] The invention relates to a gene, specifically a metallothionein gene cloned from Tetrahymena elliotti, and the recombinant engineering bacteria containing the gene has important application prospects in the treatment of heavy metal pollution in water environment. Background technique [0002] The serious threat of metals to the environment is gradually becoming a global problem. The accumulation of heavy metals in water bodies to a certain limit will cause serious harm to the water body-aquatic plants-aquatic animal system, and may directly or indirectly affect human beings through the food chain. healthy. How to scientifically and effectively solve the pollution of heavy metals to water bodies has become a research hotspot. The chemical and physical chemical methods currently used to control heavy metal pollution in water will cause pollution transfer, which is likely to cause secondary pollution, and it is difficult to deal with large watershed and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/30C12N15/70C12N1/21C07K14/825C02F3/34C12R1/19C02F101/20
Inventor 王伟郭荣许静梁爱华
Owner SHANXI UNIV