Unlock instant, AI-driven research and patent intelligence for your innovation.

A long-chain metallothionein gene and its application

A metallothionein, long-chain technology, applied in the field of bioengineering, can solve the problems of secondary pollution and difficult to deal with harmful heavy metal pollution, and achieve the effect of rapid reaction

Active Publication Date: 2019-01-15
SHANXI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current chemical and physical chemical methods used to control heavy metal pollution in water will cause pollution transfer, which is easy to cause secondary pollution, and it is difficult to deal with large watershed and low-concentration harmful heavy metal pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A long-chain metallothionein gene and its application
  • A long-chain metallothionein gene and its application
  • A long-chain metallothionein gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Amplification and mutation of metallothionein Te-MTT2-L gene and construction and identification of recombinant plasmid pSUMO-Te-MTT2-L

[0025] design primers,

[0026] (1) Primers designed for cloning gene Te-MTT2-L:

[0027] Te-MTT2-L-F: GGATCCATGGATACTCAAACTCAAAC

[0028] Te-MTT2-L-R: CTCGAGTCAGCATTTGCATTCAGAGC

[0029] (2) Primers designed for gene Te-MTT2-L mutation stop codon:

[0030] Primers for mutating stop codons

[0031] Tubian-Te-MTT2-L-F: GCTGCCAATGCAACCCTTGCAC

[0032] Tubian-Te-MTT2-L-R: GTGCAAGGGTTGCATTGGCAGC

[0033] The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0034] Using Te-MTT2-L-F / Te-MTT2-L-R, a new gene was amplified from Tetrahymena elliotti by PCR technique, and the nucleotide sequence was SEQ ID NO:1. Utilize Tubian-Te-MTT2-L-F / Tubian-Te-MTT2-L-R, obtain mutated gene Te-MTT2-L by the Escherichia coli stop codon (TAA) in the mutation gene sequence by PCR method, nucleotide sequence is S...

Embodiment 2

[0036] Example 2 Expression and Identification of Metallothionein Gene Te-MTT2-L

[0037]The recombinant plasmid pSUMO-Te-MTT2-L was transformed into Escherichia coli BL21, and a single colony was picked and cultured in LB liquid medium to the logarithmic growth phase. After being induced with IPTG, the culture was continued for 4 h, and the cells were collected by centrifugation at 1000 rpm for 5 min at 4°C. The cells were resuspended in PBS buffer, and the cells were ultrasonically disrupted by an ultrasonic cell disruptor, the whole bacterial solution and supernatant were collected, and the expression product was analyzed by 12% SDS-PAGE. The protein expressed by the E. coli cell strain not induced by IPTG For comparison. The target protein SUMO-Te-MTT2-L was expressed and its size was predicted to be 36.4KD. The results can preliminarily confirm that the expression of SUMO-Te-MTT2-L was successful ( image 3 ).

[0038] Western blotting detection of recombinant protein S...

Embodiment 3

[0039] Example 3 Escherichia coli BL21 / pSUMO and BL21 / pSUMO-Te-MTT2-L to Cd 2+ tolerance analysis

[0040] Escherichia coli BL21 / pE-SUMO and BL21 / pSUMO-Te-MTT2-L were transferred to LB medium (5 mL) containing 100 μg / mL kanamycin and cultured to OD600=0.7, and IPTG was added to a final concentration of 0.05mM, continue to culture for 4h, respectively induce the expression of SUMO-tagged protein and SUMO-Te-MTT2-L protein. The two cell strains were transferred to multi-tube LB medium (5mL) respectively, so that the final concentration was OD600=0.1, and at the same time, concentration gradients of Cd were added to the multi-tube culture medium inoculated with these two strains. 2+ , continue to cultivate for 5h, and detect the concentration of bacteria in each tube of culture medium.

[0041] Data processing: set three parallels for each group of test samples to take the average value, and draw the bacterial concentration—test sample Cd 2+ Concentration diagram ( Figure 5 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a long-chain metallothionein gene and an application thereof. A new long-chain metallothionein gene is amplified from tetrahymena elliotti by virtue of a PCR (polymerase chain reaction) technology, a mutant gene Te-MTT2-L is obtained after mutation of a codon, and the mutant gene is connected to a vector pSUMO to obtain a recombinant plasmid pSUMO-Te-MTT2-L containing the gene. After transformation of escherichia coli BL21, the escherichia coli BL21 / pSUMO-Te-MTT2-L is induced by virtue of IPTG (isopropyl-beta-d-thiogalactoside) to express out a soluble protein SUMO-Te-MTT2-L. The escherichia coli BL21 / pSUMO-Te-MTT2-L has very strong heavy metal stress tolerance and a capability of enriching heavy metal ions, and a recombinant gene engineering bacterium BL21 / pSUMO-Te-MTT2-L has a broad application prospect in the aspect of controlling water environment heavy metal pollution.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to genes, specifically a long-chain metallothionein gene cloned from Tetrahymena elliotti and its application. Background technique [0002] The serious threat of metals to the environment is gradually becoming a global problem. The accumulation of heavy metals in water bodies to a certain limit will cause serious harm to the water body-aquatic plants-aquatic animal system, and may directly or indirectly affect human beings through the food chain. healthy. How to scientifically and effectively solve the pollution of heavy metals to water bodies has become a research hotspot. The chemical and physical chemical methods currently used to control heavy metal pollution in water will cause pollution transfer, which is likely to cause secondary pollution, and it is difficult to deal with large watershed and low-concentration harmful heavy metal pollution. [0003] The biological m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/30C07K14/825C12N15/70C12N1/21C02F3/34C02F101/20
Inventor 许静郭荣王伟梁爱华
Owner SHANXI UNIV