Long-chain metallothionein gene and application thereof
A technology of metallothionein and long chain, applied in the field of bioengineering, can solve the problems of secondary pollution, harmful heavy metal pollution, etc., and achieve the effect of rapid response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 Amplification and mutation of metallothionein Te-MTT2-L gene and construction and identification of recombinant plasmid pSUMO-Te-MTT2-L
[0025] design primers,
[0026] (1) Primers designed for cloning gene Te-MTT2-L:
[0027] Te-MTT2-L-F: GGATCCATGGATACTCAAACTCAAAC
[0028] Te-MTT2-L-R: CTCGAGTCAGCATTTGCATTCAGAGC
[0029] (2) Primers designed for gene Te-MTT2-L mutation stop codon:
[0030] Primers for mutating stop codons
[0031] Tubian-Te-MTT2-L-F: GCTGCCAATGCAACCCTTGCAC
[0032] Tubian-Te-MTT2-L-R: GTGCAAGGGTTGCATTGGCAGC
[0033] The above primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0034] Te-MTT2-L-F / Te-MTT2-L-R is used to amplify a new gene from Tetrahymena elliotti by PCR technology, and the nucleotide sequence is SEQ ID NO:1. Utilize Tubian-Te-MTT2-L-F / Tubian-Te-MTT2-L-R, obtain mutated gene Te-MTT2-L by the Escherichia coli stop codon (TAA) in the mutation gene sequence by PCR method, nucleotide sequence is SEQ...
Embodiment 2
[0036] Example 2 Expression and Identification of Metallothionein Gene Te-MTT2-L
[0037]The recombinant plasmid pSUMO-Te-MTT2-L was transformed into Escherichia coli BL21, and a single colony was picked and cultured in LB liquid medium to the logarithmic growth phase. After being induced with IPTG, the culture was continued for 4 h, and the cells were collected by centrifugation at 1000 rpm for 5 min at 4°C. The cells were resuspended in PBS buffer, and the cells were ultrasonically disrupted by an ultrasonic cell disruptor, the whole bacterial solution and supernatant were collected, and the expression product was analyzed by 12% SDS-PAGE. The protein expressed by the E. coli cell strain not induced by IPTG For comparison. The target protein SUMO-Te-MTT2-L was expressed and its size was predicted to be 36.4KD. The results can preliminarily confirm that the expression of SUMO-Te-MTT2-L was successful ( image 3 ).
[0038] Westernblotting detection of recombinant protein SU...
Embodiment 3
[0039] Example 3 Escherichia coli BL21 / pSUMO and BL21 / pSUMO-Te-MTT2-L to Cd 2+ tolerance analysis
[0040] Escherichia coli BL21 / pE-SUMO and BL21 / pSUMO-Te-MTT2-L were transferred to LB medium (5 mL) containing 100 μg / mL kanamycin and cultured to OD600=0.7, and IPTG was added to a final concentration of 0.05mM, continue to culture for 4h, respectively induce the expression of SUMO-tagged protein and SUMO-Te-MTT2-L protein. The two cell strains were transferred to multi-tube LB medium (5mL) respectively, so that the final concentration was OD600=0.1, and at the same time, concentration gradients of Cd were added to the multi-tube culture medium inoculated with these two strains. 2+ , continue to cultivate for 5h, and detect the concentration of bacteria in each tube of culture medium.
[0041] Data processing: set three parallels for each group of test samples to take the average value, and draw the bacterial concentration—test sample Cd 2+ Concentration diagram ( Figure 5 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 