Unlock instant, AI-driven research and patent intelligence for your innovation.

dsRNA of aphid gene and its application in reducing the survival rate of aphid

An aphid and DNA molecule technology, applied in the field of bioengineering, can solve problems such as the ineffectiveness of anti-aphid breeding and the lack of anti-aphid genes

Inactive Publication Date: 2018-08-31
NANYANG NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the huge loss caused by aphids to agricultural production, and the lack of effective aphid-resistant genes in the existing germplasm resources of crops, conventional aphid-resistant breeding is difficult to be effective; excavate and identify new aphid-resistant genes or aphid dsRNA, and use transgenic technology to breed aphid-resistant new species. Germplasm is of great significance for ensuring food security and environmental security in our country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • dsRNA of aphid gene and its application in reducing the survival rate of aphid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Obtaining of dsRNA of aphid gene

[0038] (1) Extraction of total RNA and synthesis of cDNA

[0039] About 20 tube aphids were taken respectively, and total RNA was extracted according to the instructions of the Trizol kit of Beijing Quanshijin Company, purified with RNA Cleaning Kit, and the first strand of cDNA was synthesized by reverse transcription. The operation steps refer to the instructions of the kit.

[0040] (2) Primer design and gene cloning

[0041] Primers P1-F and P1-R were designed using Primer Primer5.0 software and synthesized by Beijing Huada Gene Company. GFP gene ( GFP ) fragment was amplified from the 16318hGFP plasmid preserved in the laboratory of the School of Life Science and Technology, Nanyang Normal University, and primers P2-F and P2-R were designed using Primer Primer5.0 software.

[0042] P1-F: 5'- TAATACGACTCACTATAGGG CAACAGTCAGCGGAAGTAC-3' (the underlined sequence is the 1st to 19th positions of SEQ ID No: 2);

[0043] P...

Embodiment 2

[0060] Example 2 SaUP Application of dsRNA in inhibiting the growth of aphids

[0061] (1) Preparation of artificial feed for aphids and preparation of feeders

[0062] References for preparation of artificial feed and feeder (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on feeding aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.) , filter artificial feed with a 0.2 μm bacterial filter, aliquot into 2.0 mL sterilized centrifuge tubes and store in a -20°C refrigerator to avoid repeated freezing and thawing.

[0063] (2) dsRNA ( SaUP dsRNA) in inhibiting the growth of aphids

[0064] The feeding method of aphids is described in the following literature: Jiao Min, Liu Shusheng. The technology of feeding aphids with artificial diet. Acta Entomological Journal of East China, 2004, 13(2): 102-109.

[0065] Aphid aphid SaUP dsRNA feeding group: put 20 3rd-instar nymphs of A. sativa in each aphid feeder,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to dsRNA of aphid gene and its application in reducing the survival rate of aphid. The dsRNA of the aphid gene is specifically a double-stranded RNA composed of the nucleotides of the sequence shown in SEQ ID No: 1 and the nucleotides of its reverse complementary sequence. The application is to introduce the dsRNA into aphids, so as to prevent and control aphids, reduce the survival rate of aphids or inhibit the expression of SaUP gene of aphids. The invention adopts the method of feeding dsRNA in vitro, utilizes the RNAi technology to silence the SaUP gene of the aphid, and causes the lethal effect of the aphid. The real-time fluorescent quantitative PCR study of SaUP gene in aphids after feeding showed that the expression of SaUP gene was obviously inhibited. It shows that the sequence of aphid SaUP gene can be applied to the study of improving wheat aphid resistance through plant-mediated RNAi technology.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to dsRNA of aphid gene and its application in reducing the survival rate of aphids. Background technique [0002] Aphids are one of the main pests that endanger crop production. In recent years, factors such as global warming and changes in farming systems have significantly enhanced the reproductive capacity and adaptability of aphids, and their harm has become increasingly serious. According to statistics, from 2010 to 2011, the aphid-damaged areas of major crops such as wheat, corn, cotton, rape, and soybean in my country accounted for 62.5%, 14%, 90%, 32%, and 23% of the planting area in that year, respectively. Taking wheat aphids as an example, wheat aphids gather as nymphs on wheat leaves, stems, ears, etc., and suck juice, causing irregular shrinkage, curling, and chlorosis of leaves, and in severe cases, plant death. The honeydew secreted by the wheat ap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11A01N57/16A01P7/04
Inventor 喻修道陈志勤贾殿勇郑远段建平
Owner NANYANG NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More