Supercharge Your Innovation With Domain-Expert AI Agents!

Method and kit for determination of human NEFM gene polymorphism rs12515 site polymorphism

A locus polymorphism, gene technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of not being able to take detection, and achieve the effect of reduced measurement cost, good yield and specificity

Inactive Publication Date: 2016-01-27
河南省职业病防治研究院
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no restriction endonuclease has been found that can recognize the base sequence containing the rs12515 polymorphic site of the NEFM gene, and PCR-RFLP technology cannot be used for detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for determination of human NEFM gene polymorphism rs12515 site polymorphism
  • Method and kit for determination of human NEFM gene polymorphism rs12515 site polymorphism
  • Method and kit for determination of human NEFM gene polymorphism rs12515 site polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs12515 Polymorphism

[0060] 1 Materials and methods

[0061] 1.1 Main reagents and instruments

[0062] Reagent: 2×PCRMix (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), restriction endonuclease AseI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0063] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0064] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0065] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-o...

Embodiment 2

[0089] Example 2 Determination of NEFM gene rs12515 polymorphism in human peripheral blood whole blood samples

[0090] The main reagents and instruments are the same as in Example 1; refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood whole blood genomic DNA, and use it as a human genomic DNA template to be tested.

[0091] The sequence search is the same as in Example 1, the upstream primer used in the PCR reaction is SEQ ID NO: 7, and the downstream primer is SEQ ID NO: 8.

[0092] Upstream primer: 5'GAGATGTATTATGCAAAGTACCAACTGAGCCAAAACAAT T AA3' (SEQ ID NO: 7);

[0093] Downstream primer: 5'TTAACATCGATCAACATAAGATTGCAAACTGT3' (SEQ ID NO:8).

[0094] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μL o...

Embodiment 3

[0109] Example 3 Determination of NEFM gene rs12515 polymorphism in human peripheral blood clot specimen

[0110] The main reagents and instruments are the same as in Example 1; refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0111] The upstream primer used in the PCR reaction is SEQ ID NO:12, and the downstream primer is SEQ ID NO:13.

[0112] Upstream primer: 5'CTTGAGATGTATTATGCAAAGTACCAACTGAGCCAAAACAAT T A3' (SEQ ID NO: 12);

[0113] Downstream primer: 5'GCAAGTACTGCTGTGTGACGTTTAACATCGAT3'

[0114] (SEQ ID NO: 13)

[0115] Except that the annealing temperature of PCR amplification is 65° C., other reaction conditions are the same as in Example 1; enzyme digestion reaction is the same as in Example 1. After 1-fold concentration, the digested product was subjected to electrophoresis for 45 min on 2.5% agarose gel at 5V / cm, and photographed for identification under ultraviolet light.

[0116] res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for determination of human NEFM gene polymorphism rs12515 site polymorphism. The method is as follows: providing to-be-tested human genomic DNA; providing upstream and downstream primers for amplification of sequences nearby human NEFM gene polymorphism rs12515 site, wherein the upstream primer has a mismatched base T; taking the to-be-tested human genomic DNA as a template, using the upstream and downstream primers for PCR amplification reaction to obtain an amplification product containing ATTAAY fragment, wherein Y is to be confirmed base C or T on the human NEFM gene polymorphism rs12515 site; providing a restriction endonuclease; using the restriction endonuclease for enzyme digestion of the amplification product to obtain a corresponding enzyme digestion product; and according to the resulting enzyme digestion product, determining whether the to be confirmed base Y on the human NEFM gene polymorphism rs12515 site is C or T. The restriction endonuclease is restriction endonuclease which only be capable of cutting one of ATTAAT fragment or ATTAAC fragment. The determination method is fast and reliable, and can greatly reduce the determination cost.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2521/301C12Q2525/117
Inventor 余善法谷桂珍马军营周文慧王思华王平
Owner 河南省职业病防治研究院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com