Method and kit for determination of human PLIN1 gene rs2289487site polymorphism
A technology of PLIN1 and site polymorphism, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of high price, and achieve the effects of reduced measurement cost, good yield and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2289487 Polymorphism
[0058] 1 Materials and methods
[0059] 1.1 Main reagents and instruments
[0060] Reagent: 2×PCRMix (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate) (Vazyme Company), restriction endonuclease (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.
[0061] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).
[0062] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested
[0063] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chlo...
Embodiment 2
[0088] Example 2 Determination of rs2289487 polymorphism in human peripheral blood whole blood samples
[0089] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.
[0090] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:
[0091] Upstream primer: 5'CATTCTGCCAGGCAGCAAGGGCTGTGGGAGGGAAGGTGA T C3' (SEQ ID NO: 7);
[0092] Downstream primer: 5'AGAGCAAGTGTTGTTAATGTCTAGAGTT3' (SEQ ID NO: 8)
[0093] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reaction system, and adjust the pH of the solution to about 7.3.
[009...
Embodiment 3
[0108] Example 3 Determination of rs2289487 polymorphism in human peripheral blood clots
[0109] Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.
[0110] The upstream primer used in the PCR reaction is SEQNO:12, and the downstream primer is SEQNO:13.
[0111] Upstream primer: 5'ATGGCATTCTGCCAGGCAGCAAGGGCTGTGGGAGGGAAGGTGA T C3' (SEQ ID NO: 12);
[0112] Downstream primer: 5'AGAGAGCAAGTGTTGTTAATGTCTAGAGTT3' (SEQ ID NO: 13)
[0113] Except that the annealing temperature of PCR amplification is 66° C., other reaction conditions are the same as in Example 1; enzyme digestion identification is the same as in Example 1.
[0114] result:
[0115] The amplified sequence (it is located at 456-627 of the base sequence of SEQ ID NO: 1, 172 bp in total), and the obtained amplification product sequence is as follows (SEQ ID NO: 14):
[0116]
[0117] The underlined part in the amplified product sequence is ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 