Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting polymorphism of site rs2853669 of TERT human gene and kit

A locus polymorphism, gene technology, applied in the direction of biochemical equipment and methods, microbial determination/examination, etc., can solve the problem of no diagnosis and treatment, and achieve the cost reduction, good yield and specificity of the measurement. Effect

Inactive Publication Date: 2015-11-25
ZHENGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gene polymorphism is an innate genetic characteristic of an individual, which does not change with the environment, nor is it a specific or non-specific clinical manifestation of a certain disease, so its application does not have a diagnostic and therapeutic role

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting polymorphism of site rs2853669 of TERT human gene and kit
  • Method for detecting polymorphism of site rs2853669 of TERT human gene and kit
  • Method for detecting polymorphism of site rs2853669 of TERT human gene and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2853669 Polymorphism

[0059] 1 Materials and methods

[0060] 1.1 Main reagents and instruments

[0061] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction endonuclease AvaII (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0062] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0063] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0064] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-out m...

Embodiment 2

[0090] Example 2 Determination of rs2853669 polymorphism in human peripheral blood whole blood samples

[0091] The main reagents are the same as in Example 1 except that the endonuclease is Sau96I; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0092] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0093] Upstream primer: 5'GCTCCCAGTGGATTCGCGGGCACAGACGCCCAAGACCGCG G T3' (SEQ ID NO: 7);

[0094] Downstream primer: 5'GGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGTTCCCC3' (SEQ ID NO: 8)

[0095] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration: 0.1-1 μM), 2×PCRMix 10 μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 2...

Embodiment 3

[0111] Example 3 Determination of rs2853669 polymorphism in human peripheral blood clot specimen

[0112] The main reagents are the same as in Example 1 except that the endonuclease is PshAI; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0113] The upstream primer used in the PCR reaction is SEQNO:11, and the downstream primer is SEQNO:12.

[0114] Upstream primer: 5'GGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCG G T3' (SEQ ID NO: 12);

[0115] Downstream primer: 5'GGAAGGGGAGGGGCTGGGA3' (SEQ ID NO: 13)

[0116] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as in Example 1.

[0117] Enzyme digestion identification: Take 10 μl of the PCR product, add 5U endonuclease PshAI, 2 μl of 10× digestion buffer and sterile double distilled water to form a 20 μl reaction system, digest in a 37°C water bat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the polymorphism of a site rs2853669 of a TERT human gene and a kit. The method includes the steps of providing to-be-detected human genome DNA; providing an upstream primer and a downstream primer for amplifying the sequence nearby the site rs2853669 of the TERT human gene, wherein the upstream primer comprises a mismatched base G; conducting a PCR amplification reaction through the upstream primer and the downstream primer with the to-be-detected human genome DNA as the template to obtain an amplification product with a fragment GGTYC or a fragment GACCGCGGTY, wherein Y represents an undetermined base C or T on the site rs2853669 of the TERT human gene; providing a restriction enzyme; conducting digestion on the obtained amplification product through the restriction enzyme to obtain a corresponding digestion product; determining whether the undetermined base Y on the site rs2853669 of the TERT human gene is C or T according to the obtained digestion product. The restriction enzyme can cut off one of the fragment GGTTC and the fragment GGTCC, or can cut off one of the fragment GACCGCGGTT and the fragment GACCGCGGTC. The detecting means is rapid and reliable, and the detecting cost is greatly reduced.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2525/117C12Q2521/301
Inventor 施学忠杨永利
Owner ZHENGZHOU UNIV