Genotyping method of human PLIN1 gene rs2289487 site polymorphism
A PLIN1, site polymorphism technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve the problem of high price, and achieve the effect of reduced measurement cost, good yield and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2289487 Polymorphism
[0058] 1 Materials and methods
[0059] 1.1 Main reagents and instruments
[0060] Reagent: 2×PCRMix (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate) (Vazyme Company), restriction endonuclease Cviqi (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.
[0061] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).
[0062] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested
[0063] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodiu...
Embodiment 2
[0089] Example 2 Determination of rs2289487 polymorphism in human peripheral blood whole blood samples
[0090] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.
[0091] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:
[0092] Upstream primer: 5'CGTGATGGAGGAGAGTCTGGAAGCTT3' (SEQ ID NO: 7);
[0093] Downstream primer: 5'ACTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG T A3' (SEQ ID NO: 8)
[0094] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reaction system, and adjust the pH of the solution to about 7.3.
[0095]...
Embodiment 3
[0109] Example 3 Determination of rs2289487 polymorphism in human peripheral blood clots
[0110] Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.
[0111] The upstream primer used in the PCR reaction is SEQNO:12, and the downstream primer is SEQNO:13.
[0112] Upstream primer: 5'ACGTGATGGAGGAGAGTCTGGAAGCT3' (SEQ ID NO: 12);
[0113] Downstream primer: 5'TACTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG T A3' (SEQ ID NO: 13)
[0114] Except that the annealing temperature of PCR amplification is 59° C., other reaction conditions are the same as in Example 1; enzyme digestion identification is the same as in Example 1.
[0115] result:
[0116] The amplified sequence (which is located at the 392-543 position of the base sequence of SEQ ID NO: 1, 152 bp in total), the obtained amplification product sequence is as follows (SEQ ID NO: 14):
[0117]
[0118] The underlined part in the amplified product sequenc...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com