Supercharge Your Innovation With Domain-Expert AI Agents!

Method and kit for determination of human POT1 gene rs1034794 site polymorphism

A locus polymorphism and gene technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem of high price, and achieve the effect of lower measurement cost, good yield and specificity

Inactive Publication Date: 2016-01-27
ZHENGZHOU UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The rs1034794 polymorphic site of the POT1 gene is detected by PCR-RFLP technology, and the required endonuclease is HpyCH4V endonuclease, which is expensive and requires the development of new detection technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for determination of human POT1 gene rs1034794 site polymorphism
  • Method and kit for determination of human POT1 gene rs1034794 site polymorphism
  • Method and kit for determination of human POT1 gene rs1034794 site polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Determination of rs1034794 polymorphism by extracting DNA from human peripheral blood leukocytes

[0060] 1 Materials and methods

[0061] 1.1 Main reagents and instruments

[0062] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction endonuclease AluI (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0063] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0064] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0065] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-...

Embodiment 2

[0090] Example 2 Determination of rs1034794 polymorphism in human peripheral blood whole blood samples

[0091] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0092] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0093] Upstream primer: 5'TCTGTTTAACATGCAAGAATTATATTCAAACTTCAGGATCAAG3' (SEQ ID NO: 7);

[0094] Downstream primer: 5'TGTATATCATAGATGGAATAGACCT3' (SEQ ID NO: 8)

[0095] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration: 0.1-1 μM), 2×PCRMix 10 μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μl of the reaction system, and adjust the pH of the solution to about 7.3.

[0096...

Embodiment 3

[0109] The genotype judgment after AluI digestion was the same as in Example 1. A total of 96 cases were detected, and the results showed that 21 cases of TT type, 38 cases of AT type and 37 cases of AA type were found at the rs1034794 locus. Example 3 Determination of rs1034794 polymorphism in human peripheral blood clot specimen

[0110] The main reagents are the same as in Example 1 except that the endonuclease is CviKI-1; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0111] The upstream primer used in the PCR reaction is SEQNO:10, and the downstream primer is SEQNO:11.

[0112] Upstream primer: 5'TCTGTTTAACATGCAAGAATTATATTCAAACTTCAGGATCAAGC3' (SEQ ID NO: 11);

[0113] Downstream primer: 5'TATCATAGATGGAATAGACC3' (SEQ ID NO: 12)

[0114] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for determination of human POT1 gene rs1034794 site polymorphism. The method is as follows: providing to-be-tested human genomic DNA; providing upstream and downstream primers for amplification of sequences nearby human POT1 gene rs1034794 site, wherein the upstream primer has a mismatched base A; taking the to-be-tested human genomic DNA as a template, using the upstream and downstream primers for PCR amplification reaction to obtain an amplification product containing AGCW fragment, wherein W is to be confirmed base A or T on the human POT1 gene rs1034794 site; providing a restriction endonuclease; using the restriction endonuclease for enzyme digestion of the amplification product to obtain a corresponding enzyme digestion product; and according to the resulting enzyme digestion product, determining whether the to be confirmed base W on the human POT1 gene rs1034794 site is A or T. The restriction endonuclease is restriction endonuclease which only be capable of cutting one of AGCA fragment or AGCT fragment. The determination method is fast and reliable, and can greatly reduce the determination cost.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6827C12Q1/6858C12Q2525/117
Inventor 姚武郝长付燕贞王团伟王彭彭冯晓蕾段晓冉暴磊李春阳吴拥军杨永利施学忠王威
Owner ZHENGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More