Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human TERT gene rs2853669-locus polymorphism investigation technology

A site polymorphism and gene technology, applied in the field of single nucleotide polymorphism determination, can solve the problems of absence of diagnosis and treatment, and achieve the effects of reduced measurement cost, good yield and specificity

Inactive Publication Date: 2015-11-18
河南省职业病防治研究院
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gene polymorphism is an innate genetic characteristic of an individual, which does not change with the environment, nor is it a specific or non-specific clinical manifestation of a certain disease, so its application does not have a diagnostic and therapeutic role

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human TERT gene rs2853669-locus polymorphism investigation technology
  • Human TERT gene rs2853669-locus polymorphism investigation technology
  • Human TERT gene rs2853669-locus polymorphism investigation technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs2853669 Polymorphism

[0060] 1 Materials and methods

[0061] 1.1 Main reagents and instruments

[0062] Reagents: 2×PCRMix (including 4 dNTP mixtures, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), restriction endonuclease Hpy188I (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0063] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PharmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0064] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0065] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-out...

Embodiment 2

[0091] Example 2 Determination of TERT Gene rs2853669 Polymorphism in Whole Blood Specimen of Human Peripheral Blood

[0092] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0093] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0094] Upstream primer: 5'GGCCCTCGCTGGCGTCCCTG3' (SEQ ID NO: 7);

[0095] Downstream primer: 5'GGCAGGACGGGTGCCCGGGTCCCCAGTCCCCTCCGCCACGT C G3' (SEQ ID NO: 8)

[0096] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, TaqDNApolymerase, TaqAntibody, Mg 2+ , buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μL of the reaction system, and adjust the pH of the solution to about 7.3....

Embodiment 3

[0109] Example 3 Determination of rs2853669 polymorphism in human peripheral blood clot specimen

[0110] The main reagents are the same as in Example 1 except that the endonuclease is Hpy188III; the apparatus is the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0111] The upstream primer used in the PCR reaction is SEQNO: 11, the downstream primer is SEQNO: 12, and the annealing temperature is 66°C.

[0112] Upstream primer: 5'CCTCGCTGGCGTCCCTGCACCCT3' (SEQ ID NO: 12);

[0113] Downstream primer: 5'AGGACGGGTGCCCGGGTCCCCAGTCCCCTCCGCCACGT C GG3' (SEQ ID NO: 13)

[0114] For PCR amplification, except that the annealing temperature is 66° C., other reaction conditions are the same as in Example 1.

[0115] Enzyme digestion identification: Take 10 μL of the PCR product, add 5U of endonuclease Hpy188III, 2 μL of 10× digestion buffer and sterile double distilled water to form a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human TERT gene rs2853669-locus polymorphism investigation technology. The method comprises the following steps: providing a human genome DNA to be detected; providing a forward primer and a reverse primer for amplifying a sequence near the human TERT gene rs2853669 locus, wherein the reverse primer has a mismatched base C; by taking the human genome DNA to be detected as a template, performing PCR amplification reaction by adopting the forward primer and the reverse primer to obtain amplification products containing YCCGA or TYCCGA fragments, wherein Y is undetermined base C or T on the human TERT gene rs2853669 locus; providing a restriction enzyme; performing digestion on the amplification products by adopting the restriction enzyme to obtain a corresponding enzyme-digested product; and determining the undetermined base on the human TERT gene rs2853669 locus to be Y, C or T according to the enzyme-digested product, wherein the restriction enzyme is capable of cutting up one of a CCCGA fragment and a TCCGA fragment, or capable of cutting up one of a TCCCGA fragment and a TTCCGA fragment. The investigation measure adopted by the invention is rapid and reliable and the investigation cost is greatly lowered.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6858
Inventor 余善法谷桂珍姜开友吕玉民王思华韩林
Owner 河南省职业病防治研究院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com