Method for labeling antibody with DNA

A DNA labeling and antibody technology, applied in the biological field, can solve the problems of weakened conjugate activity and reduced coupling efficiency, and achieves the effects of high coupling efficiency, simple reaction steps and favorable standardization.

Active Publication Date: 2016-03-02
WUHAN GENECREATE BIOLOGICAL ENG CO LTD
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Commonly used coupling methods such as glutaraldehyde method, carbodiimide method, etc. will inevitably produce self-crosslinked

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for labeling antibody with DNA
  • Method for labeling antibody with DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1 A kind of method for DNA labeling antibody

[0018] 1. The heterobifunctional cross-linking agent with maleimide group and hydroxysuccinimide group, such as: MBS (m-Maleimidobenzoyl-N-hydroxysuccinimideester), GMBS (N-γ-Maleimidobutyryloxysuccinimideester), EMCS (N-(ε-Maleimidocaproyloxy)succinimideester), SMCC (Succinimidyl4-(N-maleimidomethyl)cyclohexane-1-carboxylate), SMPB (Succinimidyl4-(ρ-maleimidophenyl)butyrate) prepared into solutions, etc.

[0019] 2. Synthesis of Thiol-Modified Oligonucleotides

[0020] Design two primers,

[0021] One thiol modification P1: HO-C6-S-S-C6-PO3-TTCTCATGTTTGACGCTT

[0022] One without any modification P2: CGGAATGGACGATATCCCGC

[0023] Using the pBR322 plasmid as a template, a 200bp fragment was amplified. The thiol primer and common primer were added to the PCR system at a ratio of 50:1. Asymmetric PCR amplification made the amplified fragment carry sulfhydryl modification.

[0024]

[0025] 3. Dialysis of Ant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for labeling antibody with DNA. The method adopts a heterotype difunctional coupling agent to activate an amino group on the antibody, and covalent bond coupled sulfhydrylation DNA is employed to form a DNA and antibody compound. The DNA and antibody compound obtained by the method of the invention has fixed molecular proportion of the antibody and the DNA, and can be used in immune PCR and corresponding experiments.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for DNA labeling antibodies. Background technique [0002] The currently used DNA antibody coupling systems mainly include: (1) streptavidin-antibody / protein A-biotinylated DNA system: Sano et al. The streptavidin part of the fusion protein can recognize the biotin on the DNA, and the protein part can recognize the Fc segment of the antibody. However, Ruzicka believes that protein A can not only bind to the IgG of specific antibodies, but also bind to irrelevant antibody IgG adsorbed on the solid phase in the sample, thereby reducing the specificity of the reaction, and there is no commercial product for streptavidin / protein A fusion protein It is not easy to promote. (2) Biotinylated antibody-avidin-biotinylated DNA system: More researchers at home and abroad use the avidin system to link DNA and antibodies. This coupling system was first introduced into the immuno-PCR t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N33/531G01N33/533
CPCG01N33/531G01N33/533
Inventor 沈鹤霄华权高徐春雷
Owner WUHAN GENECREATE BIOLOGICAL ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap