Method for labeling antibody with DNA
A DNA labeling and antibody technology, applied in the biological field, can solve the problems of weakened conjugate activity and reduced coupling efficiency, and achieves the effects of high coupling efficiency, simple reaction steps and favorable standardization.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Embodiment 1 A kind of method for DNA labeling antibody
[0018] 1. The heterobifunctional cross-linking agent with maleimide group and hydroxysuccinimide group, such as: MBS (m-Maleimidobenzoyl-N-hydroxysuccinimideester), GMBS (N-γ-Maleimidobutyryloxysuccinimideester), EMCS (N-(ε-Maleimidocaproyloxy)succinimideester), SMCC (Succinimidyl4-(N-maleimidomethyl)cyclohexane-1-carboxylate), SMPB (Succinimidyl4-(ρ-maleimidophenyl)butyrate) prepared into solutions, etc.
[0019] 2. Synthesis of Thiol-Modified Oligonucleotides
[0020] Design two primers,
[0021] One thiol modification P1: HO-C6-S-S-C6-PO3-TTCTCATGTTTGACGCTT
[0022] One without any modification P2: CGGAATGGACGATATCCCGC
[0023] Using the pBR322 plasmid as a template, a 200bp fragment was amplified. The thiol primer and common primer were added to the PCR system at a ratio of 50:1. Asymmetric PCR amplification made the amplified fragment carry sulfhydryl modification.
[0024]
[0025] 3. Dialysis of Ant...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap