A method for dna labeling antibodies
A DNA labeling and antibody technology, applied in the biological field, can solve the problems of weakened activity of conjugates and reduced coupling efficiency, and achieve high coupling efficiency, simple reaction steps, and the effect of standardization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Embodiment 1 A kind of method for DNA labeling antibody
[0018] 1. Use heterobifunctional cross-linking agents with maleimide groups and hydroxysuccinimide groups, such as: MBS (m-Maleimidobenzoyl-N-hydroxysuccinimide ester), GMBS (N-γ-Maleimidobutyryloxysuccinimide ester) , EMCS (N-(ε-Maleimidocaproyloxy) succinimide ester), SMCC (Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate), SMPB (Succinimidyl 4-(ρ-maleimidophenyl)butyrate) prepared into solutions, etc.
[0019] 2. Synthesis of Thiol-Modified Oligonucleotides
[0020] Design two primers,
[0021] One thiol modification P1: HO-C6-S-S-C6-PO3-TTCTCATGTTTGACGCTT
[0022] One without any modification P2: CGGAATGGACGATATCCCGC
[0023] Using the pBR322 plasmid as a template, a 200bp fragment was amplified. The thiol primer and common primer were added to the PCR system at a ratio of 50:1. Asymmetric PCR amplification made the amplified fragment carry sulfhydryl modification.
[0024]
[0025] 3. Dialy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

