Culture medium and method for culturing urechis unicinctus trochophore cell line
A technology of dandruff larvae and single-ringed thorn beetle, which is applied in the field of marine invertebrate cell culture, can solve the problem of inability to realize the subculture of single-ringed thorn beetle cells, and achieves good application value, strong specificity, and high passage frequency. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] The construction of embodiment 1 trochocarp larvae cell line
[0038] 1) Configure culture medium
[0039] In 1L of complete medium, 13.7gL-15 medium powder was dissolved, and 20.2g / lNaCl, 0.54g / lKCl, 0.60g / lCaCl were added 2 , 1g / lMgSO 4 , 3.9g / lMgCl 2 , 2.92g / lL-glutamine, and total volume 5% of fetal bovine serum, 2% of C. monocircleum body cavity fluid, 1% of C. monocircleum egg yolk extract, and the penicillin of final concentration 100IU / ml and Streptomycin at a final concentration of 100 μg / ml has a pH value of 7.2-7.4.
[0040] Among them, the body cavity fluid of C. unicircum: use a 20ml syringe to collect the body cavity fluid in a sterilized 15ml centrifuge tube, centrifuge at 2500g at 4°C for 10min, collect the supernatant in a serum bottle, and pass through a micropore of 0.45μm and 0.22μm Sterilize by filtration, dispense into sterilized 1.5ml EP tubes, 1ml per tube, seal the film and freeze for later use.
[0041] Among them, the yolk extract of Echi...
Embodiment 2
[0051] Embodiment 2 Molecular level species identification
[0052] The specific primer sequences COI-F5'—3'CTCAACAAACCACAAAGACATTGG and COI-R5'—3'TGTAGACCCTCTGGATGGCC were designed for the mitochondrial cytochrome c oxidase I (COI) gene of Echinacea monocircleum, and the 50th generation cells of the cell line were amplified by PCR and used as Control parietal cell COI gene, the target fragment size is 710bp.
[0053] The reaction system is 10 μl, including 1 μl of 10xbuffer, 0.8 μl of 2.5 μM dNTP, 1 μl of each 2 μM primer, 0.2 μl of template, and 0.05 μl of rTaq enzyme. The reaction program was set as pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 50 s, and 35 cycles; extension at 72°C for 5 min.
[0054] The product was subjected to gel electrophoresis with 1.2% agarose, as Figure 6 As shown, the size of the amplified target band was consistent with the expectation, and it was preliminarily determined t...
Embodiment 3
[0055] Example 3 Cell Growth Curve Determination
[0056] Take the 47th passage cells of the trochophore larvae, and adjust the cell density to 10 5 cells / ml, inoculated into 24-well plates at 1ml / well for culture, and counted every 24 hours, with 3 wells counted each time. Taking the culture time (d) as the abscissa and the cell concentration (cells / ml) as the ordinate, draw the cell growth curve. At the same time, calculate the population doubling time (T) of the cells according to the formula T=t*lg2 / lg(Nt / N0), wherein N0 is the number of cells initially inoculated, and Nt is the number of cells after cultivating for t time.
[0057] The result is as Figure 7 As shown, the cells resumed growth and entered the logarithmic proliferation phase within 1 day, entered the first plateau phase on the 5th day, and then continued to grow; entered the second plateau phase on the 8th day, and began to decline on the 9th day. According to the formula T=t*lg2 / lg(N t / N 0 ) calculat...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap