Primers, probes and method for detecting Mycobacterium tuberculosis drug-resistant gene mutation sites

A technology of mycobacterium tuberculosis and mutation sites, applied in the field of medical monitoring, can solve the problems of cumbersome operation and heavy workload

Active Publication Date: 2016-05-25
HAINAN MEDICAL COLLEGE +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of molecular biology has greatly improved the detection speed of tuberculosis drug-resistant strains, but the drug resistance of tuberculosis bacilli is caused by mutations at multiple sites on multiple genes, resulting in cumbersome operations and excessive workload for PCR-based detection methods. Large disadvantages make it difficult to promote clinical use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] The known sample 1 contains isoniazid and fonoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention, and the specific steps are as follows:

[0104] a. Extract the total DNA in the sample;

[0105] b. Using the total sample DNA extracted in step a as a template, use the primers katG-F and katG-R of the katG gene, the primers inhA-F and inhA-R of the inhA gene, and the primers rpoB-F and rpoB-R of the rpoB gene , gyrA gene primers gyrA-F and gyrA-R for the first round of PCR. The sequences of each primer are as follows:

[0106] katG-F: CTGGTCCGTACTTCCGAGCGGTCGGCGGTCACACTTTCGGTA

[0107] katG-R: TACAGTCGGTCGCGTGCCTCAACGGGTCCGGGATGGTGCC

[0108] inhA-F: CTGGTCCGTACTTCCGAGCGAAGGGATCCGTCATGGTCGAAGT

[0109] inhA-R: TACAGTCGGTCGCGTGCCTCGTTGGACACCAGCACCTCGAC

[0110] rpoB-F: CTGGTCCGTACTTCCGAGCGGGCGAGCTGATCCAAAACCAGA

[0111] rpoB-R: TACAGTCGGTCGCGTGCCTCCGACAGCGAGCCGATCAGAC

[0112] gyrA-F: CTGGTCCGTACTTCCGAGCGAGGAG...

Embodiment 2

[0152] It is known that the known sample 2 contains rifampicin and fenoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection values ​​are as shown in Table 1. The fluorescence value of the wild-type probe katG-315AGC at the 315th amino acid mutation site of the isoniazid resistance-related katG gene in this sample is 1646, which is greater than 100, and is twice the fluorescence value of the mutant probe katG-315ACC, so the The sample does not contain drug-resistant mutations related to amino acid 315 of the katG gene. The fluorescence value of the wild-type probe inhA--15C at the -15 amino acid mutation site of the isoniazid resistance-related gene inhA gene in this sample is 395.5, which is greater than 100, and is two times the fluorescence value of the mutant probe inhA--15T. times, so the sample does not contain inhA--15 ami...

Embodiment 3

[0157]It is known that the known sample 3 contains rifampicin and fenoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection values ​​are as shown in Table 1. The fluorescence value of the wild-type probe katG-315AGC at the 315th amino acid mutation site of the isoniazid resistance-related katG gene in this sample is 2043.5, greater than 100, and twice the fluorescence value of the mutant probe katG-315ACC, so the The sample does not contain drug-resistant mutations related to amino acid 315 of the katG gene. The fluorescence value of the wild-type probe inhA--15C at the -15 amino acid mutation site of the isoniazid resistance-related gene inhA gene in this sample is 380.5, which is greater than 100, and is two times the fluorescence value of the mutant probe inhA--15T. times, so the sample does not contain inhA--15 amino acid-rel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to primers, probes and a method for liquid-phase chip detection of Mycobacterium tuberculosis drug-resistant gene mutation sites. The primers, probes and method are used for detecting drug-resistant gene mutation sites in Mycobacterium tuberculosis for drugs isoniazide, rifampicin and fonoquantel. The isoniazide drug-resistant mutation sites are positioned in katG gene and inhA gene; the rifampicin drug-resistant mutation sites are positioned in rpoB gene; and the fonoquantel drug-resistant mutation sites are positioned in gyrA gene. The method comprises the following steps: respectively carrying out homology analysis according to the nucleotide sequences of the four drug-resistance related genes in the gene bank, designing the primers and probes, carrying out PCR (polymerase chain reaction) twice, carrying out molecular hybridization, and carrying out detection by using a Luminex200 system, thereby determining whether the sample contains the drug-resistant mutation sites. The detection of drug-resistant gene mutation sites is of crucial importance for treating Mycobacterium tuberculosis infection by adopting correct therapeutic schedules. The primers, probes and method have the advantages of high detection speed, high sensitivity, high specificity and the like, are simple to operate, and are beneficial to popularization and application.

Description

technical field [0001] The present invention relates to a detection of Mycobacterium tuberculosis against isoniazid, rifampicin and fenoquinones, three kinds of drug resistance-related gene mutation sites, especially a detection method of Mycobacterium tuberculosis by means of a liquid chip. The detection of gene mutation sites related to drug resistance of three kinds of drugs belongs to the technical field of medical monitoring. Background technique [0002] Tuberculosis (TB) is one of the most important infectious diseases threatening human health, and the emergence of tuberculosis drug resistance is the biggest problem in the treatment of tuberculosis. About 2 billion people are infected with Mycobacterium tuberculosis worldwide, and as many as 1.3 million people die of tuberculosis every year. In the past 10 years, due to the widespread and irrational use of antibiotics, the emergence of multidrug-resistant tuberculosis strains (MDR-TB) and extensively drug-resistant t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/32
CPCC12Q1/6816C12Q1/689C12Q2600/106C12Q2600/156C12Q2531/113C12Q2565/501C12Q2563/107
Inventor尹飞飞陈福和吕刚袁国勇朱奇轩符瑞佳梁培陈锦龙
OwnerHAINAN MEDICAL COLLEGE