Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A protein that promotes root surface colonization of Trichoderma harzianum and its application

A protein and expression plasmid technology, applied in the field of applied microorganisms, can solve the problems of obvious and stable field application effect, and achieve the effect of solving the poor colonization effect of functional bacteria, increasing the colonization amount, and promoting rapid colonization.

Active Publication Date: 2017-09-12
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the existence of a large number of indigenous microorganisms competing with SQR-T037 for nutrients and living space in the field environment, the field application effect of SQR-T037 and its related products is not as obvious and stable as in laboratory conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A protein that promotes root surface colonization of Trichoderma harzianum and its application
  • A protein that promotes root surface colonization of Trichoderma harzianum and its application
  • A protein that promotes root surface colonization of Trichoderma harzianum and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] The present invention will be further described below in conjunction with specific implementation examples. The enumerated implementation cases are only used to illustrate the implementation method of the present invention, and are not intended to limit the application scope of the present invention. Where specific implementation conditions are not indicated, it is carried out according to conventional conditions well known to those skilled in the art.

[0040] 1. Construction of yeast engineering bacteria expressing HFB protein

[0041] 1) The hfb4 and hfb8 genes (without the signal peptide coding region) were respectively cloned from the cDNA library of Trichoderma SQR-T037 by PCR technology;

[0042] The primers for cloning the hfb4 gene are as follows:

[0043] Upstream primer hfb4-F: GGCTGAAGCTGAATTCACTCAGGAGCACCAGTTCGA (SEQ ID NO.5)

[0044] Downstream primer hfb4-R: GAGTTTTTTGTTCTAGAATCTGGGGAAGGGCATCCTG (SEQ ID NO.6)

[0045] The primers for cloning the hfb8 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein for promoting root surface colorization of trichoderma harzianum and application of the protein, and belongs to the technical field of microorganisms.The HFB small protein family and the function of the HFB small protein family of participating in regulating and controlling of root surface colorization of trichoderma harzianum are found for the first time, and it is shown through research that a remarkable positive regulating and controlling effect is achieved on root surface colorization of trichoderma harzianum through the existence of the family protein.The protein is expressed and secreted in pichia pastoris through the technologies such as yeast heterologous expression and protein fusion.After the protein is purified and enriched, an outer source is added into a water-culture planting system, special protein envelops can be formed on the surfaces of roots, the hydrophilicity / hydrophobicity of the surfaces of roots can be changed, rapid colorization of plant biocontrol growth-promoting bacteria trichoderma harzianum is promoted, and the colorization amount is increased by 110-180% within 48 h compared with that of a control group without the protein.By means of the protein and the application of the protein, the problems that in application of microorganism preparations mainly prepared from trichoderma and related biological fertilizer, the colorization of functional bacteria is poor in effect, and the field application effect is instable can be effectively solved.

Description

technical field [0001] The invention relates to a protein for promoting root surface colonization of Trichoderma harzianum and its application, belonging to the technical field of applied microorganisms. technical background [0002] HFB protein is a small hydrophobic protein unique to filamentous fungi. In the reports on Aspergillus and Trichoderma, it is mentioned that members of this protein family are related to the formation of hydrophobic structures on the surface of fungal spores, the extension of hyphae, and the adhesion of hydrophobic materials, but they have not been found to be involved in the regulation of Trichoderma colonization Reports on plant root sheets. [0003] With the development of microbial technology, artificially screened and improved exogenous microorganisms and their preparations are widely used in agricultural production, environmental pollution remediation and other fields. However, due to differences in soil and crop types, changes in soil te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/37C12N15/31C12N15/81C12N1/19C12N1/14C05F11/08C12R1/84
CPCC05F11/08C07K14/37C12N1/14
Inventor 沈其荣蔡枫黄启为
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com