Esterase PHE14 as well as encoding gene and application thereof
A technology of PHE14 and esterase, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of high price of esterase and restriction of production technology.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Design of primers for esterase gene PHE14 and determination of open reading frame boundaries
[0030] The genomic DNA of Pseudomonadaceaeoryzihabitans HUP022 was extracted and verified by sequencing. The genome was annotated by bioinformatics methods, and the esterase gene was analyzed. The open reading frame of the esterase gene PHE14 was determined. The nucleotide sequence is shown in SEQ ID NO. 1, with a full length of 645 bp (from start codon to stop codon), and the amino acid sequence of esterase PHE14 encoded by it is shown in SEQ ID NO. 2, with a total of 214 amino acids. The gene is A brand new esterase gene. According to the analyzed sequence of esterase gene PHE14, the primers are designed as follows: Forward primer: 5′-CAC GAATTC GTGCTGGAATCGCCTAGC-3', the underlined part is EcoRI restriction site; reverse primer: 5'-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC3', the underlined part is the XhoI restriction site.
Embodiment 2
[0031] Example 2: Cloning of esterase gene PHE14 and vector construction
[0032] 2.1 PCR amplification
[0033] The primer designed in Example 1 (forward primer: 5′-CAC GAATTC GTGCTGGAATCGCCTAGC-3′, reverse primer: 5′-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC-3′) was sent to Shanghai Bioengineering Co., Ltd. to synthesize the primers. The synthesized primers were diluted to 10μM with TE, and the total DNA of Pseudomonadaceaeoryzihabitans HUP022 was used as the DNA template to establish the reaction system shown in Table 1. :
[0034] Table 1 PCR reaction system
[0035]
[0036] Use the following PCR amplification program to amplify the esterase gene PHE14: a.94℃denatured for 3min; b.94℃denatured for 30s, 55~65℃annealed for 0.5-1min, 72℃extended for 1min, for 20 cycles; c.72℃ Extend for 10 minutes and cool to 10°C.
[0037] The PCR products were electrophoresed on a 1% agarose gel at 120V for 20 minutes, and placed in a gel imaging system for observation. The band around 645bp was recove...
Embodiment 3
[0047] Example 3: Efficient expression of esterase gene PHE14 in E. coli BL21 (DE3)
[0048] 3.1 Preparation of E. coli BL21 (DE3) competent cells
[0049] 1. Put a small amount of E. coli BL21(DE3) strain into 5mL LB test tube solution, shake culture overnight at 37℃, 250rpm;
[0050] 2. Inoculate the E. coli BL21 (DE3) broth after shaking overnight into a 300ml LB shake flask at an inoculum of 1% volume ratio, shake culture at 37°C for 3-4h (≥300rpm) to obtain the original culture;
[0051] 3. Cool the cultured shake flask in ice water to 0°C quickly, dispense the original culture into ice pre-cooled centrifuge tubes (50 mL), and store on ice for a few minutes;
[0052] 4. Centrifuge at 4°C and 4000 rpm for 10 minutes to recover the cells and remove the supernatant;
[0053] 5. 10mL 0.1M CaCl pre-cooled with ice 2 Resuspend the cells, centrifuge at 4000 rpm for 10 min at 4°C to recover the cells;
[0054] 6. Repeat 5, using 10mL 0.1M CaCl 2 Resuspend cells in ice bath for more than 1h; ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
