Esterase PHE14 as well as encoding gene and application thereof

A technology of PHE14 and esterase, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of high price of esterase and restriction of production technology.

Active Publication Date: 2016-07-27
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the disadvantages of expensive esterase and restricted production technology in the prior art, the present invention provides a new esterase PHE14 and its coding gene and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Esterase PHE14 as well as encoding gene and application thereof
  • Esterase PHE14 as well as encoding gene and application thereof
  • Esterase PHE14 as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Design of primers for esterase gene PHE14 and determination of open reading frame boundaries

[0030] The genomic DNA of Pseudomonadaceaeoryzihabitans HUP022 was extracted and verified by sequencing. The genome was annotated by bioinformatics methods, and the esterase gene was analyzed. The open reading frame of the esterase gene PHE14 was determined. The nucleotide sequence is shown in SEQ ID NO. 1, with a full length of 645 bp (from start codon to stop codon), and the amino acid sequence of esterase PHE14 encoded by it is shown in SEQ ID NO. 2, with a total of 214 amino acids. The gene is A brand new esterase gene. According to the analyzed sequence of esterase gene PHE14, the primers are designed as follows: Forward primer: 5′-CAC GAATTC GTGCTGGAATCGCCTAGC-3', the underlined part is EcoRI restriction site; reverse primer: 5'-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC3', the underlined part is the XhoI restriction site.

Embodiment 2

[0031] Example 2: Cloning of esterase gene PHE14 and vector construction

[0032] 2.1 PCR amplification

[0033] The primer designed in Example 1 (forward primer: 5′-CAC GAATTC GTGCTGGAATCGCCTAGC-3′, reverse primer: 5′-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC-3′) was sent to Shanghai Bioengineering Co., Ltd. to synthesize the primers. The synthesized primers were diluted to 10μM with TE, and the total DNA of Pseudomonadaceaeoryzihabitans HUP022 was used as the DNA template to establish the reaction system shown in Table 1. :

[0034] Table 1 PCR reaction system

[0035]

[0036] Use the following PCR amplification program to amplify the esterase gene PHE14: a.94℃denatured for 3min; b.94℃denatured for 30s, 55~65℃annealed for 0.5-1min, 72℃extended for 1min, for 20 cycles; c.72℃ Extend for 10 minutes and cool to 10°C.

[0037] The PCR products were electrophoresed on a 1% agarose gel at 120V for 20 minutes, and placed in a gel imaging system for observation. The band around 645bp was recove...

Embodiment 3

[0047] Example 3: Efficient expression of esterase gene PHE14 in E. coli BL21 (DE3)

[0048] 3.1 Preparation of E. coli BL21 (DE3) competent cells

[0049] 1. Put a small amount of E. coli BL21(DE3) strain into 5mL LB test tube solution, shake culture overnight at 37℃, 250rpm;

[0050] 2. Inoculate the E. coli BL21 (DE3) broth after shaking overnight into a 300ml LB shake flask at an inoculum of 1% volume ratio, shake culture at 37°C for 3-4h (≥300rpm) to obtain the original culture;

[0051] 3. Cool the cultured shake flask in ice water to 0°C quickly, dispense the original culture into ice pre-cooled centrifuge tubes (50 mL), and store on ice for a few minutes;

[0052] 4. Centrifuge at 4°C and 4000 rpm for 10 minutes to recover the cells and remove the supernatant;

[0053] 5. 10mL 0.1M CaCl pre-cooled with ice 2 Resuspend the cells, centrifuge at 4000 rpm for 10 min at 4°C to recover the cells;

[0054] 6. Repeat 5, using 10mL 0.1M CaCl 2 Resuspend cells in ice bath for more than 1h; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses esterase PHE14 as well as an encoding gene and an application thereof. A novel enzyme gene PHE14 is developed from (Pseudomonadaceae oryzihabitans) HUP022, the whole length is 645bp, and the esterase PHE14 encoded by using the gene contains 214 amino acids. By cloning the esterase gene PHE14 and connecting the gene with an expression vector pET-28a (+) and converting escherichia coli BL21 (DE3), after culture and inducible expression, the recombinant expressed esterase PHE14 can be obtained. The esterase PHE14 can be used for preparing chiral methyl lactate, the esterase PHE14 of recombinant expression is taken as a catalyst, and (S)-methyl lactate of which the optical purity is greater than 99% can be prepared. The esterase PHE14 has very high application values in fields such as biochemical engineering and biological medicines.

Description

Technical field [0001] The invention belongs to the fields of biochemical and biotechnology, and specifically relates to an esterase PHE14 and its coding gene and application. Background technique [0002] Different enantiomers of chiral drugs often exhibit completely different physiological activities and toxicities. For example, R-type "Thalidomide" is an analgesic and analgesic for pregnant women, while S-type "Thalidomide" is teratogenic to fetuses. Effect; the barbiturate S-(-) isomer has the effect of inhibiting neural activity, while the R-(+) isomer has an excitatory effect. Therefore, the synthesis of chiral compounds in the pharmaceutical industry is of great significance. In order to reduce the enantiomers with toxic side effects and reduce their biological activity, the synthesis of optically chiral drugs has always been the focus of the pharmaceutical research field. In addition, due to the huge demand for chiral chemicals in the chemical industry, the synthesis of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/16C12N15/55C12P41/00C12P7/62
CPCC12N9/16C12P7/62C12P41/001
Inventor胡云峰王依龙张云
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI