Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rice yellow green leaf trait gene ygl8 and application thereof to rice breeding

A yellow-green leaf and gene technology, applied in the field of genetics and breeding, can solve the problems of affecting the F1 purity of hybrids, identifying the purity of hybrid seeds restricting the development of the seed industry, loss of agricultural production, etc. The effect of convenient and broad application prospects

Active Publication Date: 2016-08-03
WUHAN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the climate is abnormal, the CMS line will affect the purity of the hybrid F1 due to self-fertilization, which may cause serious losses to agricultural production
The lack of ideal technical methods for identifying the purity of hybrid seeds has always been one of the reasons restricting the development of my country's seed industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice yellow green leaf trait gene ygl8 and application thereof to rice breeding
  • Rice yellow green leaf trait gene ygl8 and application thereof to rice breeding
  • Rice yellow green leaf trait gene ygl8 and application thereof to rice breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Positional cloning of rice yellow-green leaf gene ygl8 and functional complementation of YGL8 gene

[0026] 1. Rice material:

[0027] The yellow-green leaf mutant ygl8 of rice is preserved in the mid-term bank of agricultural germplasm resources in Hubei Province (preservation number HB2016001, Institute of Grain Crops, Hubei Academy of Agricultural Sciences); its wild-type variety is the indica variety "Guangzhan 63S".

[0028] The rice yellow-green leaf mutant ygl8 is produced by the spontaneous mutation of Guangzhan 63S, and the mutant phenotype is yellow-green leaf ( figure 1 ). In addition, the growth and development of ygl8 was severely retarded or even stagnated in Wuhan, Hubei, but the growth and development in Lingshui, Hainan was similar to that of the wild type ( figure 2 ). After multiple generations of breeding, the ygl8 mutation phenotype was inherited stably.

[0029] 2. Population construction and genetic analysis

[0030] The mutant ygl...

Embodiment 2

[0075] Embodiment 2 identifies ygl8 gene in rice material

[0076] According to the results in Example 1 of the present invention, the ygl8 gene is derived from a point mutation of the LOC_Os06g04150 gene, that is, the 673rd nucleotide C of SeqIDNO.2 is mutated into the 673rd nucleotide T of SeqIDNO.1 . Therefore, this embodiment adopts the method of PCR-sequencing to identify whether the rice material contains the ygl8 gene, and if the genome of the rice material contains the sequence shown in SeqID NO.1, it contains the ygl8 gene. Adopt CTAB method to extract rice material DNA (the same method in embodiment 1), carry out PCR amplification with the primer (YGL8MutationF: CGCGCCTACTTCAACTCCA and YGL8MutationR: GATCATCTGCTTCGCCTCCT) of the two ends of ygl8 mutation site, and carry out sequencing to PCR product, sequencing result is consistent with ygl8 The sequence (SeqIDNO.1) of the coding region of the sequence (SeqIDNO.1) was compared, and the sequence (SeqIDNO.1) correspon...

Embodiment 3

[0081] Example 3 The yellow-green leaf mutant ygl8 containing the ygl8 gene is applied in the rice breeding process

[0082] The yellow-green leaf mutant ygl8 is a spontaneous mutation of the photothermo-sensitive sterile line Guangzhan 63S, which is a sterile line itself and can be directly used in rice breeding.

[0083] First, the ygl8 gene can be used in hybrid rice breeding F 1 Purity identification of generation hybrids. Using the mutant ygl8 as the female parent and other rice materials as the male parent, the F 1 The generation hybrid plants have normal green leaf phenotype, while the hybrids in F 1 The seeds produced by the selfing of the female parent in the first-generation hybrids and the grown plants have a yellow-green leaf phenotype, which can be distinguished with the naked eye. In this embodiment, the F of the hybrid combination ygl8 (female) / 9311 (male) 1 Generation seeds, 126 seedlings, of which 123 seedlings showed normal green leaf phenotype, and 3 see...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice yellow green leaf trait gene ygl8 and application thereof to rice breeding and belongs to the field of genetic breeding. The nucleotide sequence of the rice yellow green leaf trait gene ygl8 is as shown in Seq ID NO.1, and the nucleotide sequence of a wild type gene YGL8 corresponding to the rice yellow green leaf trait gene ygl8 is as shown in Seq ID NO.2; coded protein of the wild type gene YGL8 is key enzyme, namely magnesium protoporphyrin IX methyl transferase, in the chlorophyll synthesis pathway, and the nucleotide sequence of the coded protein is as shown in Seq ID NO.3. The ygl8 gene has wide application prospect in hybridization F1-generation hybrid purity identification work and sterile line self-fertilized breed conservation purity identification work of rice breeding.

Description

technical field [0001] The invention belongs to the field of genetic breeding, and in particular relates to rice yellow-green leaf trait gene ygl8 (yellowgreenleaf8) and its application in rice breeding. Background technique [0002] Rice (Oryza sativa L.) is one of the most important food crops in the world. The emergence of hybrid rice has greatly increased the yield of rice and made a great contribution to alleviating the food crisis in China and the world. However, in the seed production process of two-line hybrid rice, the fertility of the sterile line will be affected by light and temperature (Liao Fuming, Yuan Longping, 2003). When the climate is abnormal, the CMS line will affect the purity of the hybrid F1 due to self-fertilization, which may cause serious losses to agricultural production. The lack of ideal technical methods for identifying the purity of hybrid seeds has always been one of the reasons restricting the development of my country's seed industry. In...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12Q1/68
CPCC12N9/1007C12Q1/6895C12Q2600/13C12Y201/01011
Inventor 王兆海李阳生洪潇胡柯柯
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More