Rice yellow green leaf trait gene ygl8 and application thereof to rice breeding
A yellow-green leaf and gene technology, applied in the field of genetics and breeding, can solve the problems of affecting the F1 purity of hybrids, identifying the purity of hybrid seeds restricting the development of the seed industry, loss of agricultural production, etc. The effect of convenient and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Positional cloning of rice yellow-green leaf gene ygl8 and functional complementation of YGL8 gene
[0026] 1. Rice material:
[0027] The yellow-green leaf mutant ygl8 of rice is preserved in the mid-term bank of agricultural germplasm resources in Hubei Province (preservation number HB2016001, Institute of Grain Crops, Hubei Academy of Agricultural Sciences); its wild-type variety is the indica variety "Guangzhan 63S".
[0028] The rice yellow-green leaf mutant ygl8 is produced by the spontaneous mutation of Guangzhan 63S, and the mutant phenotype is yellow-green leaf ( figure 1 ). In addition, the growth and development of ygl8 was severely retarded or even stagnated in Wuhan, Hubei, but the growth and development in Lingshui, Hainan was similar to that of the wild type ( figure 2 ). After multiple generations of breeding, the ygl8 mutation phenotype was inherited stably.
[0029] 2. Population construction and genetic analysis
[0030] The mutant ygl...
Embodiment 2
[0075] Embodiment 2 identifies ygl8 gene in rice material
[0076] According to the results in Example 1 of the present invention, the ygl8 gene is derived from a point mutation of the LOC_Os06g04150 gene, that is, the 673rd nucleotide C of SeqIDNO.2 is mutated into the 673rd nucleotide T of SeqIDNO.1 . Therefore, this embodiment adopts the method of PCR-sequencing to identify whether the rice material contains the ygl8 gene, and if the genome of the rice material contains the sequence shown in SeqID NO.1, it contains the ygl8 gene. Adopt CTAB method to extract rice material DNA (the same method in embodiment 1), carry out PCR amplification with the primer (YGL8MutationF: CGCGCCTACTTCAACTCCA and YGL8MutationR: GATCATCTGCTTCGCCTCCT) of the two ends of ygl8 mutation site, and carry out sequencing to PCR product, sequencing result is consistent with ygl8 The sequence (SeqIDNO.1) of the coding region of the sequence (SeqIDNO.1) was compared, and the sequence (SeqIDNO.1) correspon...
Embodiment 3
[0081] Example 3 The yellow-green leaf mutant ygl8 containing the ygl8 gene is applied in the rice breeding process
[0082] The yellow-green leaf mutant ygl8 is a spontaneous mutation of the photothermo-sensitive sterile line Guangzhan 63S, which is a sterile line itself and can be directly used in rice breeding.
[0083] First, the ygl8 gene can be used in hybrid rice breeding F 1 Purity identification of generation hybrids. Using the mutant ygl8 as the female parent and other rice materials as the male parent, the F 1 The generation hybrid plants have normal green leaf phenotype, while the hybrids in F 1 The seeds produced by the selfing of the female parent in the first-generation hybrids and the grown plants have a yellow-green leaf phenotype, which can be distinguished with the naked eye. In this embodiment, the F of the hybrid combination ygl8 (female) / 9311 (male) 1 Generation seeds, 126 seedlings, of which 123 seedlings showed normal green leaf phenotype, and 3 see...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
